Transcript asmbl_62385

Sequence
Transcript Sequence for observation asmbl_62385 of TGE0006720:
AGACAGTCCTCTGGGTCACCTGCCTCTGAAAATCGTGTCTTGCTTGCCGCCACTGCTGCTAGCATGGCAGCGCCCTCCGCCTGGCTTCCTGTTTCTGGAATGGGCTGGTGTGAGCGGAGTCCCGCGAGATGCCGGGCTCGTCCTGAGCCTGCGGGACGCGGGGCCGGTTCCTCGTTACTCATCCGCACTCTTTCTTTGTGCTCTTTCTCCTTTCTCCTCCTTTAGACAAGCTGGCCAGCCCGCCGGCCTCGGCCGCAGCCTCCAGCCCTAGCTCCTCTCCATCTCCACAGCCCGTTTCAGAGCCCGACCTGTGCTCAGAGCCACACCAGCTCGCTTCCAAGGGAGCTGGTTTTCCATCTGCCCCCGTCGGCAAGAGCCCCATGGTGGAGCAGGCTGTCCAGACCGGTTCCCTCGATAACCTGAATGCCAGGAAGCCGTCGCCCGGCAAGGGCACAGTGGGGATGCAGCTCAACGGGCGCCCGACCCCGCCAGGCAGCAAGAGCGCCAGCGATGTAGCCCAGCCGGCCACAGTGCAAACCCAAGGGCAGGTGAACGACGAAAACAGAAGGCCCCAGAGGAGGAGATCAGGGAATAGACGAACCAGGAATCGCTCCAGGGGGCAAAGCCGCCCAACTCACGTCAAGGAGAATACCATCAAGTTCGAAGGCGACTTTGATTTTGAGAGTGCAAACGCCCAGTTCAACCGTGAGGAGCTGGACAAGGAGTTTAAGAAGAAACTGAATTTTAAAGATGACAAAGTGGAGAAAGGGGAGGAGAAGGACCCGACACTGGTGACCCAGAGTGACGAGGTGCCAGCCGAGGAGGACCACCTGGGGCCCAACTGCTACTACGACAAGTCCAAGTCCTTCTTCGACAATATCTCCTCTGAACTCAAGACCAGTTCCAGGAGGACCACATGGGCCGAGGAGAGGAAGCTCAACACGGAGACCTTCGGGGTGTCGGGAAGGTTTCTCCGTGGCCGCGGTTTCCGGGGCGGATTGCGAGGGGGCAGGGGCACCGGTACGACCCGGCGCAACCCTACTTCCCACCGAGCTGGGACGGGCAGAGTGTGAGGGGGCAGCCAGAGGCTCCTGCCGAAGCAGCGGAGACGAATCTGTGAGGGCCACGGAGGACGCCGCATTTACGGGAGACGCTGGGCCCCTCTGTTTACTGTTTGCAGAATTCCCACGTGCTACTTTTGTTCTGGACTTCACGCGACTTGGACGTGGTCTGAGTTGGAACCACTTGTTTTGGGGAAGTGTTTATGGGAAGCCTCTCCGGGGCATCAAGATCTTTTGTTCTTACTTGCACACAGTGTAATCTAAGGTTTTGGTATTTTGCAAAGAGGTTTCTAGAACGAAAGCTCGATTCTCATTTCGTGACTTTTTTTTGGCCGCTTTGACTTTGAAAGTGGAACCAAATCTCCTTGGGCAGTGTGGCAGCCGGGCGCGGCTCTGTAATCCAGCTGGCCCCTGGTGTTGCTGGCCTGGCACCCCCGTGCCAGGTGGGGTCTCAGGAGCCAGGCAGGGCCAGCACAGGGGTGAGGGGGTGGGTGGGTCTAGGACAG