Transcript asmbl_62200

Sequence
Transcript Sequence for observation asmbl_62200 of TGE0006693:
CTCTCGTTCTGTTTGATCAGCTGCACAACTGTCCGCTTGGTGAATGGACCATCATTTCTAGATGAGGATGCTGAGGACCAGAGAGGGGAAGTGATTTGCCTAGGGTCATACAGTGGGAAGAAGTGGAGCAGGGCCTCTAGTCCACGACCCCTGATTCCACACCTCGTGTTCGTGCTGAGACCCCAGGCTGCTTCCCAGGTCCTCTGGGACAGCTCCTTCCACAGCCAGGACCATGGGCAGCAACAAGAGCAAGCCCAAGGACGCCAGCCAGCGGCGCCGCAGCTTGGAGCCTGCCGAGAACGCCCACGGTGGTGGCGGGGGCGCCTTCCCCACCTCACAGACCCCCAGCAAGCCGGCTTCCGCTGATGGCCACCGCGGCCCCAACACGGCCTTCAGCCCCGCGGCCTCCGAGCCCAAGCTCTTCGGGGGCTTCAACTCCTCGGATACCGTCACCTCCCCGCAGAGGGCGGGGCCGCTGGCTGGGGGAGTGACCACCTTTGTGGCCCTCTATGACTATGAGTCACGGACAGAGACCGACCTATCCTTCAAGAAAGGGGAGCGGCTCCAGATTGTCAACAACACAGAGGGAGACTGGTGGCTTGCCCACTCGCTCAGCACCGGACAGACGGGCTACATCCCCAGCAACTACGTGGCGCCCTCTGATTCCATCCAAGCCGAGGAGTGGTACTTTGGCAAGATCACCAGACGGGAGTCAGAGCGGTTACTGCTCAACGCGGAGAACCCGAGAGGGACCTTCCTAGTGCGAGAAAGCGAGACCACGAAAGGTGCCTACTGCCTCTCAGTGTCTGACTTCGACAATGCCAAGGGCCTCAACGTGAAGCACTACAAGATCCGCAAGCTGGACAGTGGCGGCTTCTACATCACCTCTCGCACCCAGTTCAACAGTCTGCAGCAGCTCGTAGCCTACTACTCCAAACATGCTGATGGCCTGTGCCACCGCCTCACCACTGTGTGCCCCACATCCAAGCCACAGACTCAGGGCCTGGCCAAGGATGCCTGGGAGATCCCCCGGGAGTCACTGCGGCTGGAGGTCAAGCTGGGCCAGGGCTGCTTTGGAGAGGTGTGGATGGGGACCTGGAATGGCACCACCAGGGTGGCCATCAAAACCCTGAAGCCGGGCACGATGTCTCCAGAGGCCTTCCTGCAGGAGGCCCAGGTGATGAAGAAACTCAGGCACGAGAAGCTGGTGCAGCTGTATGCGGTGGTGTCTGAGGAGCCCATCTACATCGTCACGGAATACATGAGCAAGGGGAGTTTGCTGGACTTTCTCAAGGGGGAGACAGGCAAGTACCTGCGGCTGCCTCAGCTGGTGGACATGGCTGCTCAGATTGCCTCAGGCATGGCATATGTGGAGCGGATGAACTACGTCCACCGGGACCTCCGAGCTGCCAACATCCTGGTTGGAGAGAACCTTGTGTGCAAAGTAGCTGACTTCGGGCTGGCTCGGCTCATCGAAGACAATGAGTACACAGCCCGGCAAGGTGCCAAATTCCCCATCAAGTGGACAGCTCCAGAAGCTGCCCTCTATGGCCGGTTCACCATCAAGTCGGACGTGTGGTCCTTTGGGATCCTGCTGACAGAGCTTACAACAAAGGGACGGGTGCCCTACCCTGGGATGGTAAACCGAGAGGTGCTGGATCAGGTGGAGCGGGGCTACCGGATGCCCTGCCCGCCTGAGTGTCCTGAGTCCCTGCACGACCTCATGTGCCAGTGCTGGCGGAAGGAGCCAGAGGAACGGCCCACCTTTGAGTACCTACAGGCCTTTCTGGAGGACTATTTCACATCCACCGAGCCCCAGTATCAGCCTGGAGAGAACCTATAGGGAG