Transcript asmbl_62142

Sequence
Transcript Sequence for observation asmbl_62142 of TGE0006675:
GGCTGCCCCACGGCGCGTGGGGACTTCTGGGCCGTAGGCGAGGTTTGGAACCCCAACCGTGGTGGTAGGAGGTTCGGGGGTGGCCGGCCCAGAAGATGGCAGTGAACGTATATTCAACATCAGTTACCAGTGATAATCTAAGTCGACATGACATGCTGGCCTGGATCAATGAGTCTCTGCAGTTGAATTTGACAAAGATAGAACAGTTGTGCTCAGGGGCTGCCTATTGTCAGTTTATGGACATGCTGTTCCCTGGCTCCATTGCCTTGAAGAAAGTGAAATTCCAAGCTAAGCTAGAACATGAATACATCCAGAACTTCAAAATACTACAAGCAGGTTTTAAGAGGATGGGTGTCGACAAAATAATTCCTGTGGACAAATTAGTAAAAGGAAAGTTTCAGGACAATTTTGAATTCGTTCAGTGGTTCAAGAAGTTTTTTGATGCAAACTATGATGGAAAAGACTATGACCCTGTAGCTGCCAGACAAGGTCAAGAAACTGCAGTGGCTCCCTCCCTTGTTGCTCCAGCTCTGAACAAACCGAAGAAACCTCTCAGCTCTAGCAGTGCAGCTCCACAGAGGCCCATTGCAACACACAGAACTACTGCAACCCCTAAGGCTGGCCCGGGTGTGGTGCGAAAGAATCCTGGTGTGGGCAATGGGGATGACGAAGCAGCCGAACTGATGCAACAGGTCAACGTATTGAAACTTACCGTTGAAGACTTGGAGAAAGAGAGAGACTTCTACTTTGGAAAGCTAAGGAACATTGAATTGATTTGCCAGGAGAATGAGGGGGAAAACAACCCTGTATTGCAGAGGATTGTGGACATTCTCTATGCCACAGATGAAGGCTTTGTGATACCTGACGAAGGGGGTCCACAGGAGGAACAAGAAGAGTATTAACAGCCTGGACCAGCAGAGGAACGTTGGAATTTTTCACTCCAAATCATGTGCTTAACTGTAAAATACTCCCTTTTATTATTCTTAGAAGACTCACTGGTTTCTTTTCATAAGCAAAAAGTACCTCTTCTTAAAGTGCACTTTGCAGAAGTTTCACTCCTTTTCCAATAAGTTTGAGTTAGGAGCTTTTTACCTTGTAGCAGAGCAGTATTAACATCTAGTTGGTTCACCTAGGGAACAAAGAGGCTGACCATGGGGCTCACCGAATGGATACTGGTAACACTGATTACTGGAGAAGGTGTTTTTATGTGATATGCTGAGGTGGAGACCTCAGAGAAAATGTAAAGACTGATTTGAATTTTAAGCTAATGTGAAATCTTGGCAGAGAACGTTTTAATAAATAAATGCCTTAAGAGTATTTAAAATATGCTTCCATATTTCAAAATATAAAATGTAACCTGACGGGATTTTGTGTGTTCAACCTTGTGTCTGGAAAGGAAGGGCCAGACCTTGGAACCTTTGGAACCTGCTGTTCACAGGCCTTGCAGGGCAGCTTGAATCTTCACAGGCCTAACCTTGGCCCAGAAGGGAAGTTTAAAATGTTGCTCTGTAAAGCCGTGTGGTGTCCTTGATCAATTGCATCTCTGCTAGGAAGCAAGAGGCGTTGCCTGAATGAATAAGAGTATGTTTTAGTCCTGAGATGTTTGAGTTGAATAGCTCGATTTTCATTGAGCATTTCTCTGACGATTTTTCCAATTACCCCTGAAATTTCTATGTATTGTGTTTATTTTTGGGAAATGAGGTGTGTTCAGTTTTTAAATCTAACAACTACTTTTTGGGACTTGCCCACATCTCTGGGATTTGAATGGGGGTTGTGTCCCATTTTACTGTTTTTTTAAGTTTACATTTAACATATTTCTCTTCTCTGCTCCCCTTGCCCACTGGGGACTCCTCTTTGGCTCCTTAAAGTTTGCTGCTTAGAGTGGAAGTTGAACAGGCAGGTGATCATGCTGCAAGTTCTTTCTGGACCTCTGGCAAAGGGAGTGACCAGTGAAGGCCATCGCTACCATGGGATCTGCAAGGCTGGGTGTTTTTGGTACCTGCTGTCCACAGCCTTCCACTGTTATCGGAATACTTTGCCAGTGCACTAATCTCTTTGGAGATAAAATTCGTTAGTGTGTTACTAAATGTTAATTTTCTTTTGCAGAAAATACAGTGCCATGTCTGAATTAATTATTAATATTTAAAATATTTCATTCCTTAACACTCCCTCATTTGCTTTGCCCACAGCCTATTCAGTTCCTTTGGCAGAATTCTGCAAAATGTGTGTCACCCACTACTGAGATTGTTCAGCCCCTGATGTATTTGTATTGATTTGTTTCTGGTGGTAGCTTGTCCTAAAATGTGTGTAGAAAGCCGGTATTTTATGATAAATTGTTGTGTAGTGCATGCTCTGTGTGGAATTCAGAGGAAAACCCAGATTCAGTGATTAACAATGCCAAAAATGCAAGTAACTAGCCATTGTTCAAATAACAGTGGTGCTATTTCTCTTTCGTGGCCTTTTAGACTTTTGTTGCCCTAAAATTCCATTTTATTGGGAACCATTTTCCACCTAGTCTTTCTTGACAGGGTTTTTTTCTACTTTAAACAGTTTCTAAATAAAATTCTGTATTTCAAGAGTGTCATGTCTTCTGAAATTTGTCTTGCCTTGGGTATTTTCTTTTAGGTTCAAATGATAAGGTATCGATGCTTCTTTCTTAAATTAG