Transcript asmbl_62141

Sequence
Transcript Sequence for observation asmbl_62141 of TGE0006675:
CGGGGTCGGGCGGTTTGAACGAGACGAAGACGAAACCGGAGCCGGGCACGGGCAGTGGACGCGGTTCCGCTGAGAGCCGAAGATGGCAGTGAACGTATATTCAACATCAGTTACCAGTGATAATCTAAGTCGACATGACATGCTGGCCTGGATCAATGAGTCTCTGCAGTTGAATTTGACAAAGATAGAACAGTTGTGCTCAGGGGCTGCCTATTGTCAGTTTATGGACATGCTGTTCCCTGGCTCCATTGCCTTGAAGAAAGTGAAATTCCAAGCTAAGCTAGAACATGAATACATCCAGAACTTCAAAATACTACAAGCAGGTTTTAAGAGGATGGGTGTCGACAAAATAATTCCTGTGGACAAATTAGTAAAAGGAAAGTTTCAGGACAATTTTGAATTCGTTCAGTGGTTCAAGAAGTTTTTTGATGCAAACTATGATGGAAAAGACTATGACCCTGTAGCTGCCAGACAAGGTCAAGAAACTGCAGTGGCTCCCTCCCTTGTTGCTCCAGCTCTGAACAAACCGAAGAAACCTCTCAGCTCTAGCAGTGCAGCTCCACAGAGGCCCATTGCAACACACAGAACTACTGCAACCCCTAAGGCTGGCCCGGGTGTGGTGCGAAAGAATCCTGGTGTGGGCAATGGGGATGACGAAGCAGCCGAACTGATGCAACAGGTCAACGTATTGAAACTTACCGTTGAAGACTTGGAGAAAGAGAGAGACTTCTACTTTGGAAAGCTAAGGAACATTGAATTGATTTGCCAGGAGAATGAGGGGGAAAACAACCCTGTATTGCAGAGGATTGTGGACATTCTCTATGCCACAGATGAAGGCTTTGTGATACCTGACGAAGGGGGTCCACAGGAGGAACAAGAAGAGTATTAACAGCCTGGACCAGCAGAGGAACGTTGGAATTTTTCACTCCAAATCATGTGCTTAACTGTAAAATACTCCCTTTTATTATTCTTAGAAGACTCACTGGTTTCTTTTCATAAGCAAAAAGTACCTCTTCTTAAAGTGCACTTTGCAGAAGTTTCACTCCTTTTCCAATAAGTTTGAGTTAGGAGCTTTTTACCTTGTAGCAGAGCAGTATTAACATCTAGTTGGTTCACCTAGGGAACAAAGAGGCTGACCATGGGGCTCACCGAATGGATACTGGTAACACTGATTACTGGAGAAGGTGTTTTTATGTGATATGCTGAGGTGGAGACCTCAGAGAAAATGTAAAGACTGATTTGAATTTTAAGCTAATGTGAAATCTTGGCAGAGAACGTTTTAATAAATAAATGCCTTAAGAGTATTTAAAATATGCTTCCATATTTCAAAATATAAAATGTAACCTGACGGGATTTTGTGTGTTCAACCTTGTGTCTGGAAAGGAAGGGCCAGACCTTGGAACCTTTGGAACCTGCTGTTCACAGGCCTTGCAGGGCAGCTTGAATCTTCACAGGCCTAACCTTGGCCCAGAAGGGAAGTTTAAAATGTTGCTCTGTAAAGCCGTGTGGTGTCCTTGATCAATTGCATCTCTGCTAGGAAGCAAGAGGCGTTGCCTGAATGAATAAGAGTATGTTTTAGTCCTGAGATGTTTGAGTTGAATAGCTCGATTTTCATTGAGCATTTCTCTGACGATTTTTCCAATTACCCCTGAAATTTCTATGTATTGTGTTTATTTTTGGGAAATGAGGTGTGTTCAGTTTTTAAATCTAACAACTACTTTTTGGGACTTGCCCACATCTCTGGGATTTGAATGGGGGTTGTGTCCCATTTTACTGTTTTTTTAAGTTTACATTTAACATATTTCTCTTCTCTGCTCCCCTTGCCCACTGGGGACTCCTCTTTGGCTCCTTAAAGTTTGCTGCTTAGAGTGGAAGTTGAACAGGCAGGTGATCATGCTGCAAGTTCTTTCTGGACCTCTGGCAAAGGGAGTGACCAGTGAAGGCCATCGCTACCATGGGATCTGCAAGGCTGGGTGTTTTTGGTACCTGCTGTCCACAGCCTTCCACTGTTATCGGAATACTTTGCCAGTGCACTAATCTCTTTGGAGATAAAATTCGTTAGTGTGTTACTAAATGTTAATTTTCTTTTGCAGAAAATACAGTGCCATGTCTGAATTAATTATTAATATTTAAAATATTTCATTCCTTAACACTCCCTCATTTGCTTTGCCCACAGCCTATTCAGTTCCTTTGGCAGAATTCTGCAAAATGTGTGTCACCCACTACTGAGATTGTTCAGCCCCTGATGTATTTGTATTGATTTGTTTCTGGTGGTAGCTTGTCCTAAAATGTGTGTAGAAAGCCGGTATTTTATGATAAATTGTTGTGTAGTGCATGCTCTGTGTGGAATTCAGAGGAAAACCCAGATTCAGTGATTAACAATGCCAAAAATGCAAGTAACTAGCCATTGTTCAAATAACAGTGGTGCTATTTCTCTTTCGTGGCCTTTTAGACTTTTGTTGCCCTAAAATTCCATTTTATTGGGAACCATTTTCCACCTAGTCTTTCTTGACAGGGTTTTTTTCTACTTTAAACAGTTTCTAAATAAAATTCTGTATTTCAAGAGTGTCATGTCTTCTGAAATTTGTCTTGCCTTGGGTATTTTCTTTTAGGTTCAAATGATAAGGTATCGATGCTTCTTTCTTAAATTAG