Transcript asmbl_6131

Sequence
Transcript Sequence for observation asmbl_6131 of TGE0006634:
CAGGCGCAGTTATGCGGTAGGTTCCCAAGATGTCGTTCCCCAAGTACGAGCCGTCGCGCCTGGCCACCTTGCCCTCTACCCTTGACCCAGCTGAGTATGACATATCCCCGGAAACCCGGAAGGCGCAAGCCGAGCGGTTGGCCATAAGATCTCGGCTGAAAAGAGAGTACCTGCTGCAGTACAACAACCCTAGCCGCCGAGAGCTCATTGAAGATCCTGCCTTGACTCGTTGGACCTATGCAAGATCTGCAAATATCTATCCCAATTTCAGACCCACTCCCAAGACCTCACTCTTAGGAGCTGTTTTTGGATTGGGGCCCCTTTTCTTCTGGTATTATGTTTTCAAAACTGACAGAGATAGGAAAGAAAAACTTATTCGGGAAGGAAAATTGGATCGAACATTTAACATCTCATATTAATTCTGGCAATGATGACTATGTGTATTATGTTT