Transcript asmbl_60690

Sequence
Transcript Sequence for observation asmbl_60690 of TGE0006627:
AATCCTGGCTTCATTTATCACCTTTCTTTTAAAAATTCTTACTGGTTACATGATGAATAAAATCAAATCACCATCTTTCGGCTGAGCTCATGATGATTTGCTTTTTTCTGATAAAGCTGGTCTGTTGTGATGACCCACTGTCTTTAAGCTGAGGAACAACCAGTTTTGTGAAGTGTGTTAAATTTTTTCTTTATAGGAGAGCGAAGAAGCAAAGAGGCTAAGAGAAGAGCGCCTTGCACAGTATGAGTCAAAGAAAGCCAAAAAGCCTGCACTTGTTGCCAAGTCTTCCATCTTATTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCTAAATTGGAGGAGTGCGTCAGGAGCATTCAAGCAGATGGCTTGGTCTGGGGCTCTTCTAAACTAGTTCCAGTGGGGTATGGAATTAAAAAACTTCAGATACAGTGTGTAGTAGAAGACGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGACGTGGCTGCTTTCAACAAGATCTGAAATCCATCATGGATCATTACTCTTAAATAAAAGCTTGAAAGACA