Transcript asmbl_60689

Sequence
Transcript Sequence for observation asmbl_60689 of TGE0006626:
CTCTTCGGTGCCGTGGAGGTACTAATTTAAGAGATGCCCCTTTTATTAATTTATTTTCAAACCCAAAAAAAAGCCACGGATGATTTATGGGCCATTTAATTCAGAGCCCTGGTTTTTACGTTGAAGAGTGAGATTAACATACTTTGACCTTTAACCTTCGGCACGGTGCGGCGGAGGGAAACGCCTCCGTCTCTATATAAGGAATTTCCCGGACTCTTGCGGCCTCTTTTTTTCCTCTTAACGTTCAGCGAGAACTGCAAACGATCCTGTTTCCTCCGCTGCTGCCCAGTTGCCGGACCAGCAAACGCCATGGGTTTTGGAGACCTGAAAAGCCCCGCTGGCCTCCAGGTGCTCAACGACTACCTGGCGGACAAGAGCTACATCGAGGGGTATGTACCATCACAAGCAGATGTAGCAGTATTTGAAGCAGTCTCTGGCCCACCACCTGCCGACTTGTACCATGCCCTACGTTGGTATAATCACATCAAGTCTTACGAAAAGGAAAAGGCCAGCCTGCCTGGAGTGAAGAAAGCTTTGGGCAAATATGGCCCTGCTAATGTGGAAGACACCACTGGAAGTGGAGCTACAGATAGTAAAGATGATGATGACATTGATCTCTTTGGATCTGATGATGAAGAGGAGAGCGAAGAAGCAAAGAGGCTAAGAGAAGAGCGCCTTGCACAGTATGAGTCAAAGAAAGCCAAAAAGCCTGCACTTGTTGCCAAGTCTTCCATCTTATTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCTAAATTGGAGGAGTGCGTCAGGAGCATTCAAGCAGATGGCTTGGTCTGGGGCTCTTCTAAACTAGTTCCAGTGGGGTATGGAATTAAAAAACTTCAGATACAGTGTGTAGTAGAAGACGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGACGTGGCTGCTTTCAACAAGATCTGAAATCCATCATGGATCATTACTCTTAAATAAAAGCTTGAAAGACA