Transcript asmbl_60646

Sequence
Transcript Sequence for observation asmbl_60646 of TGE0013675:
CAGTTTTCACTTGCACAGCCAGTGACTAGTCTTGAGCTCTCTTCCCGCGCAAATGGGAGCTTCCTTGGAACATGGAGTACGGAAAGGATCGTCATTTCTTTAAAACGTTTTTTTCAGGAAATTTCCCCAAGAACGATTTGTTTCCAGAGGACCAGTGGAATTTGATTTGAAGAATGGCCGCGGCATCTCAAGGCCTGAGTATGAGTTCCAGTTCACATGATAATGGTAGAGAGAACTTTCGCGAGAGGCTTCTGGATATCGATTATAATCTAGGAGATCTAGAGGTGGAGCAACTAAAGTTTCTCTGCCAAGACCTCGTCTCCCGCAAGAATCTGGAGAAATGCAGCTCGGCCTCGGATATTTTTGAACATCTGTTGGCAAGGAAGCTGCTGAGTGAGGAAGACCCCTTCTTGCTGGCAGAACTCCTCTATATCATCAAGCAGAACTCACTGCTGAAGTACCTCCACTACACCAAAGAGCAGGTGGAGAATTTGCTGCCCACGAAAAGGAAGGTGTCTCTGTTCAGACCTCTCTAAGTTTCCTGGGACATCTGGAGAAACAAGCTCAAATAGGTGAAGATGATCTGAAGGTGCTAGAGGACCTCTGTGCAAAAGTTGCACCTAGTCTTGGGAGAAAGATAGAAAAATATAAAAAAGAGAAAGCCTTCCAGGTAGTGACATCTCCTGTAGACAAGGAAACTGAATCATTGCCTCAAGGAAAGGAAGAAGTTTTTTCCTGTTCAGACGTTCAACAATTTCTTGGAGCCTTACCGGCAAGTTCATTGAAGTCACCTGTGTACAAGATGGATCGGAAATGTAGAGGCCAGTGCGTTATTATCAACAACCACAGCTTTACCGTTACCTCACTGTCAGAAAGACGAGGGACCCAAAAAGATGCTGAGTGCCTTACACATGTGTTTAAGTGGCTTGGGTTCAATGTAAATATATATAATGATGTGACTAAAGAAAACCTGGAGGAAGTTCTGATAAAATTTCAGAGCCATCCAGACCATGCTGATGGAGACTGCTTCGTGTTCTGTGTTCTGACCCATGGGAAATTTGGAGCTGTCTACTCTTCGGATGGGGTCCTCATTCCCATTCGGGAGATCATGTCTCACTTCACAGCCCTGCAGTGCCCTGGTCTGGCTGACAAACCCAAACTCTTCTTCATCCAAGCCTGCCAAGGAGAAGAGATACAACTTTCTGTATCCATTGAAGCAGATGCTATAAATCCTGAGCCCACACACCCTCCCCTTCAAAACAGTGTTCCAAATGAGGCCGATTTCCTTCTTGGTTTGGCCACAGTCCCTGGCTACGTATCTTTTCGGCATACGACGGAAGGTAGCTGGTATATTCAATCTCTGTATAATCATTTGAAGGACTTGGTCCCAAGACATGAAGATATCTTATCCATTCTCACTGCTGTCAATGATGATGTAAGTCGCCGAGGTGGAACAAGGAAACAGATGCCTCAACCTGCTTTCACACTACGTAAAATTCTCATATTCCCTGTACCAGAGGAAGAACTTTGATTATAGTAGCGAGTTTTCATTGACTCTTAGTCTTGAAAGGAACCTTGTCATCTTTTCCAATTTTCACTCAGCATAGGAATCAGATGGTGAACTGGTCTCCCCTGTCATTCTTATAATAAGAAATGCCTTGCTTGTTTCCTGACATGGCAAATTCTGTTTTCTTTCGTTCTTTTTGACAAGTCTAAACATTAGAAAACTTTCTTTATCGATGCCTTGGATTGTAATCATGGCTTTAGTTGTGCACTCTGAAAAAAAAGTAATTGGCCTCAGTTTGTGTATCTGTGAAGTCAAAGCTGAGACCAGGTACATTTTAAGATTCCTCTTAGTTCTAGGAACCAATGTTCTTAGATTTCCCCTCTATATGACCACTCTTTGTTATACTTCTGTGTGACCTCTGCATGGCCTTGTTTTGGACATTGGCTGGTGACAAGACCATGGTTTGCTGACCCTCTCTCTGCTCTCCCCTTCCCAAGTCTTCTCTTCTGCACATCTACTGGGGGGAAAATGTCCTGCTTTAGAGTCTAGGAGGGTGCAAGAACTGTTTTTCTTGGGTTGGGAACTGGGTTGGCTCTTGGAAGATGACAGCTCAGTGTGAAGAGAGACACATCCAGCTACTCTGGGAACAGAAACTTGACAACTTGATGTTCCTTCCATGTTGGTCACAACCTCTCAGATGCTGGTGATGGAACGTTTTTTTCAATTTCGAGAGGAATTTTTCTTTTTAAATTTTTGGAAGAAATTAAATTTTAATTCCTGGAAAGAGGGAGATTGAAGCCTTCAATTTTAGATGAAGAGGCTGAGGCCCAAGGAGGCAGAGCAATTTGCTACAACCTTTCAACCTGTTATTGTTTACATGATTTTATTTCCCATGTAAGTGAACTGGACTGTCAGGGGACATAACAGAACTTTATGAATGTCTCCTTGAATATACAGCTGCTCAGGAAAGATGTCAGGGAGTGAAGAAAACTCTCAGTGATGCCTAATTTTATAATTATTTCTGTGAAAGTCAAATTAATTTATGGTGAACTCACTATGAGAAATATTTGTAAGAACTTTGTTATAATGTAGCTAGTAATCACATGGGTTTGACTGTAGCTTGACAAAGAAAACGAATCTAACACATATGTCAGGATGGTCCTCCAAAACTATTGTTCATACAAGTCGAAACTAACAGCTGGTGTTTACAGTCTTTGTCCTATTGGATATGCACAGCTTTTGGCCATTTAACAGTCCTCTGCAAGTGAAGCGTGCAGTAGTACAAAGGAGAGAGCAAAGAAGAATCTGGAGATAGAAACCTTGGGTTTTGATTTTACCTTGTGATTCCCTTGTTCTGAGACAGTAGCTCAAACTAATTTTTCAAACTTTCTCTATAAAGTAGAGAAAATACTATCTGTTGGGAGGATTAAGGAATATATATATATATATATTCC