Transcript asmbl_60588

Sequence
Transcript Sequence for observation asmbl_60588 of TGE0013670:
AATATGTATATAGTTTATGTAAATATTAAATTACTTTAGTAGAAGTATTTCCTAGACTTAAAAGTACTAATGTGCAGTATATTAATTATAATGATAGCAGTTTGAAATTTTGATATTCACTTAAAACTTAACTGCAGTGGTGCCTACATTAACATTTATGTCTCATTTTTTTGCAGCAAGGAGTGAATAATGCTGAAAAATTTGACTATGTGATGCAGTTTTTGAATAAGATGGCTGGTAATGAATATGTTGGATTCAGTAATGCAACGTTTCAGTCTGAAAGAGAAAGTGGAGATCGAAATTTTGCAATAGGATATTACTTAAAAGAAAAAAAGTGTTTTCCAGAAGGTACAGATATGGTTGGTATATTAGACTTCTATTTCCAGCTGTGCTCCATTGAAGTAACTTGTGAATCAGCTAGTGTGATGGCTGCAACACTGGCTAATGGCGGTTTCTGTCCAATTACTGGTGAAAGAGTGCTGAGCCCTGAAGCAGTTCGAAATACACTGAGTTTGATGCATTCCTGTGGCATGTATGATTTCTCGGGGCAGTTTGCTTTCCACGTTGGTCTTCCTGCAAAATCTGGAGTTGCTGGGGGCATTCTTTTAGTTGTACCCAATGTCATGGGCATGATGTGCTGGTCTCCCCCTCTGGACAAGATGGGCAACAGTGTTAAGGGAATTCACTTCTGTCATGATCTTGTTTCTCTGTGTAATTTCCATAACTATGATAATTTGAGACACTTTGCAAAAAAACTTGATCCTCGTAGAGAAGGTGGTGATCAAAGGCATTCCTTTGGACCATTGGACTATGAAAGTCTCCAACAAGAACTTGCTTTAAAAGAGACAGTATGGAAAAAAGTGTCACCTGAGTCAAATGAGGACATCTCTACAACTGTAGTATATAGAATGGAAAGTCTGGGAGAGAAAAGCTAAAAGAAATGAGTTCTAGTTTCAGAACATTCTTCATTTAACCTTTCGAACACCTTTAGCTTTTTTGCATACTATATATATTTATTTGAGTGTTTGTGTTCTTAACCTTGGGTGCTTGAGCCATAAAGCTATTTTTTTTCTTTTAATCTTTGTGTAAAGATAATAGATTAAAAAGTGGAATTGCCAGGT