Transcript asmbl_60204

Sequence
Transcript Sequence for observation asmbl_60204 of TGE0013634:
CTTCCGAGCACAGCATGGCGGTCAAGGTGCAGACAACCAAGCGAGGTGATCCTCATGAGTTAAGAAACATATTCCTGCAGTATGCCAGTACTGAGGTTGATGGAGAACATTACATGACCCCAGAAGATTTCGTCCAGCGCTATCTTGGACTGTATAATGATCCAAATAGCAATCCGAAGATTGTGCAGCTCTTGGCAGGAGTAGCCGATCAAACCAAGGATGGATTGATCTCCTATCAAGAGTTTTTGGCTTTTGAATCTGTTTTATGTGCTCCAGATTCCATGTTCATAGTGGCTTTCCAGTTGTTTGACAAGAGTGGAACTGGAGAGGTGACATTTGAAAATGTCAAAGAAATTTTTGGACAGACTATTATTCATCATCATATACCTTTTAACTGGGACTGTGAATTTATCCGACTGCATTTTGGGCATAATCGAAAGAAGCATCTTAACTACACAGAATTCACACAGTTTCTCCAGGAGCTACAATTGGAACATGCAAGACAAGCCTTTGCACTTAAAGACAAAAGTAAAACTGGCATGATTTCCGGTCTGGATTTCAGTGACATCATGGTTACCATTCGGTCTCACATGCTTACTTCCTTCGTGGAGGAGAACTTAGTTTCAGCAGCTGGAGGAAGTATCTCACACCAGGTTAGCTTCTCCTACTTCAATGCATTTAACTCCTTACTGAATAACATGGAGCTTGTTCGTAAGATATATAGCACTCTAGCTGGCACAAGGAGAGATATTGAAGTCACAAAAGAGGAATTTGCCCAGAGTGCCATACGCTATGGACAAGTCACTCCATTAGAAATTGATATCCTATACCAGCTTGCAGACTTATATAATGCTACAGGGCGCTTGACTTTGGCAGATATTGAGAGAATAGCCCCGTTGGCTGAGGGGGCCTTACCTCACAACCTGGCAGAACTTCAGAGACAGCAATCTCACGGTTTAGGCAGGCCTGTGTGGCTCCAGATTGCCGAGTCTGCTTACAGATTCACTCTGGGCTCAGTTGCTGGAGCTGTGGGAGCCACTGCAGTATATCCTATAGATCTGGTGAAGACGCGCATGCAAAACCAGCGTGGTACTGGCTCTGTTGTGGGGGAGCTGATGTACAAAAACAGCTTTGACTGTTTTAAGAAAGTCTTGCGTTATGAGGGCTTCTTTGGACTCTACCGAGGTCTGATACCACAGCTTATAGGGGTTGCTCCAGAAAAGGCCATTAAACTGACTGTTAATGATTTTGTTCGGGACAAATTTACTGGAAGAGATGGCTCCATTCCACTTTTTGCAGAAATCCTTGCTGGAGGTTGTGCTGGTGGCTCTCAGGTCATCTTTACCAACCCATTGGAGATAGTAAAGATTCGCCTGCAGGTAGCTGGAGAGATCACTACAGGACCCAGAGTCAGTGCCCTGAATGTGCTCCGAGACCTGGGACTTTTTGGTCTGTATAAGGGTGCCAAAGCGTGTTTCCTCCGAGACATTCCCTTCTCTGCAATCTATTTTCCTGTTTATGCTCATTGCAAAATACTTCTGGCTGATGAAAATGGACACGTGGGAGGTCTCAATCTCCTTGCAGCTGGAGCCATGGCAGGTGTGCCTGCTGCTTCTCTGGTGACCCCTGCTGATGTCATCAAGACAAGACTGCAAGTGGCTGCCCGTGCTGGCCAGACGACATACAGTGGTGTCATCGACTGTTTCAGGAAGATACTCCGGGAAGAAGGGCCCTCAGCTTTTTGGAAGGGGACTGCAGCTCGCGTGTTTCGATCCTCTCCTCAGTTCGGTGTTACCTTGGTCACCTATGAACTTCTCCAGCGGTGGTTTTACATTGATTTTGGAGGCCTCAAACCCTCTGGCTCAGAACCAACACCTAAGTCACGCATCGCAGACCTTCCTCCTGCTAGTCCGGATCACATCGGTGGATACAGACTCGCCACAGCCACTTTTGCTGGCATTGAAAACAAGTTTGGCCTTTATCTCCCCAAATTTAAATCTCCTAGTGTTGCTGTGGTTCAGTCAAAGGCAGCGACAGCAGCTCAGTGATGACATAACTGTTGAGTGTGGCAAAACGGCACCCTGGAGAGGCCTAGGACAGCAGCCCTGTAATGTATCTAGTCAGCTGCATGGTGCTGACTGAGCTGAGGAGTCAAACTATTCTTTCTATATGACATATACATATACTTGTTTATAAAGTAATCATCTGCCCAGGAAAAAAAAACACAATGCAGTTTCAAGCTTTAGTCTTACATGTTAAAATGTTTTCCAAGCCTTGGCATGAATTAGTGTTCTAGACTGCTTTGCACAGCTTGCACTTATAGTGACTGTACATATTGTACATCTTTGTACAGAGACATCTTGGCACCTCATCCCAACCACATTTATAGAATGAAATGCAGTTCTGAGTGGCTTGAAATGTACAGAATGTTTTGAAAGTGTTTTATTAAGAATCACACGAAAATAAATGTATTACAATTAAATTCATTCCTATTGGTGACTTATGGACATGAAGCATCAATATTGGATGTATTTAATTCTTAATTTGTTTTCCATTCTGGAATAAAAAAGTATCTGCTGATAAGAGGTATAACAAGACCAGTGCTAACACCATTGAATAATAGATCCTTTGGAAAAGATGCATGCCAGTGGATGCCAGAGGACCAGGCTAATGACTTGCGTGTGCTGATGTGTTTCCATTTGTATTTAACGTGTGTGTAGATCCTCCCCTGTTCATCAATCAAAAGGCATTTTCTAGACAGCTCCTCTCCTGTCAGTGTGCATATGCAAAGAGGGACGTCTCCAGCATTACTGGCTTAGTTTCGCCTTCCTCTGACACAGCAAGGCAAGGGCCTAGCTTTCAAAAAAGTAAAGGATACTTTGGCAATTTTCCTTCATATGGATATGATTCCAGTAAAAAATAAAATGCACACCAAAATGTA