Transcript asmbl_60120

Sequence
Transcript Sequence for observation asmbl_60120 of TGE0006531:
GCGACGCCGAGTGAGGCTGAGGCTGGGGGCGAATCGCCGCAGAGCTGCGTGTCGGCATCGCACTCTGATTGGACAGCGGGGAAGCCTGTTAGCTTATTGGCCCCGCTGATCCCGCCCCATAGCGCGGGGCAGCCTTTAACCTTTAGCCCAAGCGGGCGCCAGCCACTCAGATCGCTTCTTGTTGGTATATGCAGCGGCAGTGGCCGCCGGCGGAGCAGTCTGAGCCAGACGATGAGGCCGGGGACGGGAGCCGAACGTGGAGGCCTCATGATGGGGCACCCTGGCATGCATTATGCCCCAATGGGAATGCACCCTATGGGTCAGAGAGCAAATATGCCTCCTGTACCTCATGGAATGATGCCGCAAATGATGCCCCCAATGGGAGGACCGCCAATGGGACAAATGCCTGGAATGATGTCTTCGGTAATGCCTGGAATGATGATGTCTCATATGTCTCAAGCTTCCATGCAGCCTGCCTTACCGCCAGGAGTAAATAATATGGATGTAGCAGCAGGTATGTATGCCATTTGTGGTGAAATCAATGTGGACTGAACATAAATCACCTGATGGAAGGACTTACTACTACAATACTGAAACAAAACAGTCTACTTGGGAGAAACCGGATGATCTTAAAACACCTGCTGAGCAACTTTTATCTAAATGCCCCTGGAAGGAATACAAATCTGACTCTGGAAAGCCTTACTATTACAATTCTCAAACAAAGGAATCCCGCTGGGCCAAACCTAAAGAACTTGAGGATCTTGAAGCAATGATCAAAGCTGAAGAAAGCAGTAAGCAAGAGGAGTGCACCACAGCATCAACAGCCCCAGTTCCTACAACAGAAATTCCGACCACAATGAGCACCATGGCTGCTGCAGAAGCAGCAGCTGCTGTCGTTGCAGCAGCCGCCGCTGCCGCAGCAGCCGCCGCTGCAGCCAATGCCAGTTCTTCCACCTCTGCTTCTAATACAGTGGGTGGAACTGTTCCGGCTGTTCCTGAGCCTGAAGTTACTTCAATTGTTGCTACTGTTGTAGATAATGAAAACACAGTAACAATTTCAACTGAGGAACAAGCACAACTTACTAGTACCCCTGCTGTTCAGGATCAAAGTGTTGAAGTGTCTAGTAATGCTGGAGAAGAAACATCAAAGCAGGAAACCTTAGCTGATTTTACTCCCAAGAAAGAAGAGGAGGAAAGCCAACCAGCAAAAAAAACATATACTTGGAATACAAAGGAGGAGGCAAAGCAAGCATTTAAAGAATTATTGAAAGAAAAGCGGGTACCATCTAATGCTTCATGGGAGCAAGCTATGAAAATGATCATTAATGACCCACGATACAGTGCTTTAGCAAAGTTGAGTGAAAAAAAGCAGGCCTTTAATGCTTATAAAGTCCAGACAGAGAAAGAAGAAAAAGAAGAAGCAAGATCAAAGTACAAAGAGGCTAAGGAATCCTTTCAGCGTTTTCTTGAAAATCATGAGAAAATGACTTCCACAACCAGATACAAAAAAGCAGAGCAAATGTTTGGAGAGATGGAAGTCTGGAATGCAATATCAGAACGTGATCGTCTTGAAATCTATGAAGATGTTTTATTCTTTCTTTCGAAAAAAGAAAAGGAGCAAGCAAAGCAATTGCGAAAGAGAAATTGGGAAGCCTTAAAAAACATACTTGACAACATGGCTAACGTAACATACTCAACTACTTGGTCAGAAGCCCAGCAGTATCTGATGGATAATCCAACTTTTGCAGAAGACGAGGAATTACAGAACATGGATAAAGAAGATGCATTAATTTGCTTTGAAGAACATATTCGTGCTTTAGAAAAGGAAGAAGAAGAAGAAAAACAGAAGAGTTTGCTGAGAGAAAGGAGACGACAGCGTAAAAACAGAGAATCTTTTCAGATATTTTTAGATGAGCTGCATGAACATGGACAACTGCATTCTATGTCATCTTGGATGGAATTGTATCCAACAATTAGTTCTGACATTAGATTCACTAATATGCTTGGTCAGCCGGGATCAACTGCACTTGACCTTTTCAAGTTTTATGTTGAGGATCTTAAAGCACGTTATCATGATGAGAAGAAGATAATAAAAGATATTCTAAAGGATAAAGGATTTGTAGTTGAAGTAAATACTACTTTTGAAGACTTTGTGGCAGTAATCAGTTCAACTAAAAGATCAACCACACTAGATGCTGGGAACATTAAGTTAGCTTTTAATAGTTTACTAGAAAAGGCAGAAGCCCGTGAACGTGAAAGAGAAAAAGAGGAGGCTCGGAAGATGAAACGAAAAGAATCTGCTTTTAAGAGTATGTTGAAACAAGCTACTCCTCCAATAGAATTGGATGCTGTCTGGGAAGATATCCGGGAGAGATTTGTAAAAGAGCCAGCATTTGAGGACATAACTCTAGAGTCTGAAAGAAAACGAATATTTAAAGATTTTATGCATGTGCTTGAGCATGAATGTCAGCATCATCATTCAAAGAACAAGAAACATTCTAAAAAATCTAAAAAACATCACAGGAAACGTTCCCGTTCTCGATCGGGGTCAGATTCAGATGACGACGACAGCCATTCAAAGAAAAAAAGACAGCGATCAGAGTCTCGTTCTGCTTCAGAACATTCTTCTAGTGCTGAGTCTGAGAGAAGTTACAAGAAGTCAAAAAAACATAAGAAGAAAAGCAAGAAGAGGAGGCATAAATCTGACTCTCCAGAGTCAGATGCTGAGCGAGAGAAGGATAAAAAAGAGAAAGACCGGGAAAGCGAAAAAGAGAGAACTAGACAAAGATCAGAATCAAAACACAAATCACCTAAGAAAAAGACTGGAAAGGATTCTGGTAATTGGGATACTTCTGGCAGTGAACTGAGTGAAGGGGAATTGGAAAAGCGCAGAAGGACCCTTTTGGAGCAACTGGATGATGATCAATAAATTATACCAAATATATGTTTACAGTATGGTTTAAAGTCTAATTCAGACCAGGGACTCTATTTTAAGTTCAATGGAAATAACACTGGGTTTTAATTATATCACAGGAGAAAAAAAAAGTGCATTTAAGTATTGTTATTGTGGACTTTATAAAAGCAAAGGAAATTGAAAGTAACTTTCGATTCTGTATCAAGAATCATATTTTCATACAGTCATGTCTTTGTGTCCCTTTCATAGGGCACCGCAGGATGGATTAAAGGTGGCAATTTACTGATAACTGCAAATGTCTCTACTTTGTTCTAAAGTCTAAGTGATGAGGTGATTTGATTTACTTTATAGAAGTTGGATTTTGAAGATATAGTG