Transcript asmbl_60104

Sequence
Transcript Sequence for observation asmbl_60104 of TGE0006524:
GGCCGAGCGTATAAAGCCGCGCAGAGAGCGTGAAACAAAGCAGTCGGATCGGAATTGGACTTGGGGTGCGCCGTGTGGAGTCAGGCATAAAACTTGTTGGAGGGGAGTAACGAGCCTGCTCCTCCAGCTCTCCTCATCTGTGCGGGTTCCCACCAGCCTTGCGATTTATTTTTATATCTGCTTTTTTTATATATAGAGAAATATATATACATATATATTTTTTTCCCCATAAGAGAAAATTTCTGTTCCAAGAGAAAATAAGGCAAGATCAATGAAGGAGAGAAGAGCCAGCCAGAAATTATCCAGTAAATCTATCATGGATCCTAATCAGAACGTGAAATGCAAGATAGTAGTGGTGGGAGACAGTCAGTGTGGGAAAACCGCGCTGCTGCATGTCTTCGCCAAAGACTGCTTCCCCGAGAATTACGTCCCTACAGTGTTTGAGAATTACACGGCCAGTTTTGAAATCGACACACAAAGAATAGAGTTGAGCCTGTGGGACACTTCGGGTTCTCCTTATTATGACAACGTCCGGCCCCTCTCTTACCCAGATTCTGATGCCGTGCTGATTTGCTTTGACATCAGTAGACCAGAGACTCTAGACAGTGTCCTAAAAAAGTGGAAAGGTGAGATCCAGGAGTTTTGCCCCAACACCAAAATGCTCATGGTTGGCTGCAAATCTGACCTTCGGACAGATGTTAGTACATTAGTAGAACTCTCAAATCACAGACAGACACCAGTGTCTTATGATCAGGGGGCAAACATGGCCAAACAGATTGGAGCTGCCACTTATATTGAATGCTCAGCATTACAGTCGGAAAATAGCGTCAGAGACATTTTTCATGTTGCCACTTTGGCATGTGTAAACAAGACAAATAAAAACGTTAAGCGGAACAAATCACAGAGGGCCACAAAGCGGATTTCACATATGCCCAGCAGACCAGAACTCTCAGCAGTTGCTACGGACTTACGAAAGGACAAAGCGAAGAGTTGCACCGTGATGTGAATCTCCCGTTATCTTTAATGAGGACAAGGAAATCTAGTGTAAAAAAACACCACAACAAAACAAAAAGGTGAAGTCTGAATGAAGTGCACAGCCAAAGTCACATATTCTGGAGGCTTAGGAGGCATTTGAAAGGATGCTCATCTTTTTGGAATCCTGTCCTTAGGTTCGGCATGTAGAACAAGTGGTGAAAAGTGAATACATTGAAGTGTTCTGAAGTGTGACTTGAAAAATATGCCAAAAAAGAGAGATTCAGATGGTCTAGAGGTAGATGAGGAGGAATGCGAGTACCTCCAAGAAGAAAAATCCCGCTCTGAATGGTGCTTGTGTTATCGTTTTCTTTGTTGTAATCTATTCATGAATCTCTACTTTGATTTAATTTTTAAATGTTTTAATCTCCTTTACAAAAAGTATATATTAATATACCGTCCTCATTGGGGAACTGGCACTGTGACCTTAGCATTTAGTTTTCTAGAGGATGTGATCTAATTTCCTCCTAGCTCATCATTAAAATGGAAATTATATCAGGACCCATGGGATATCCAGAGGAAAAGTTTGTGAGGCTTTGAAATCTTGCCTTCCTGAAGAGAGCTGAGCGAGATGGTTCTAAAGAAAGGCTTTTGCGGTCTTGCAAGATATGCAGACGGGCACTACAAAGATCGAATAGATTGAATAGAAAAATGGTGTCGATTTTTATTCAGTCTGATGGTTCTGTTCATCATTGTGATTGTCATTAAAAAGTGGTAAATTGCTCAATGTAATATTTTTGTGCGCTGTTTAGAAAAGAGGGTTGTGATTTTTTTGCCATCGTTGATGAAAATGCAAAGTCAAATAAAAGGTGTCTTGGTTTGGTGTCATAGAATGATCCAAGGGGAAAAAAATGTAGGTACTATTTTCACCTGAAGAGATAAGGAATGAAGGAATAGTAGCAGAAAGCACAGTTTGTGAGTAAGCGGTCTGGAATTAACTTACCAAAAGTACAAAGCAAAAGGCCTATTGTTTGGGAGGTGAAGCTCTAAAGCTGGCAGCATCTGATGATCTGTTGGTTTATTTCGTTTTACTTAAATGAACATGACAAGAGAGGGATCCTCTTGTCCAAGCCTTAGAGAATTTTTAGAGAGAAATTATGTAATGTCCATTCTGACACTATGCTAGCCGTTTCTAAAGAGTGATTGCTAAACCTCACTTAACCAGATTCTGCCAAGGCCCGTGTTCAATACTTGATTGCAGTTACATAAAATAATCAACATTTAAAATAGTTTACAGATATTTTTCGACCAGTTCCTTTTAGAGTTTCTTTCAGAGAAGAAACCAGATCTGACCTGTTTATTGTTGGCGCTTGTTGAAAACGAGCTTTCTTTCCAATGATAAAGCTTCATTTTTGAAGTGTTGAAGCTGTGCTCCCATTAAATTGTGGCAGGAGAGGAGATTAAGATAATTACAACACTTAGTTCTATGTCTTACAAGCACTTTGTTTTGTCTCTGCAAGAAAATACCATTCCAGCCATTTCTCATGAAATAACAGACGTTTTACCAACATAATATGCTTTGACTGATGCAGCATTATGCTTTGGGCAGTATTACAAAATAGCTGGCAAGTGCTTTCTGTATTTAAATATTGTAAAAAGAAAATAAGTTATAACTGTTATAAAGCAGAACTTTCGTTGCATTTTTTAAAATGTTGAAGTCAGTTTGTATGTTTGGTCAATGTTTCCGCAGTATTTATTAAAACATACTTTTTTTTCTTCAAATAAAAAAGTAACCATG