Transcript asmbl_60018

Sequence
Transcript Sequence for observation asmbl_60018 of TGE0006507:
GCCGTCGCGAGCTCGGCGCTGCCGGGCAGCCGTGTGGGAGCGGGTGTGAGACCGCCGTGCGGGCCGCGGGAATGTTCCGAAAGGCCCGGCGAGTGAACGTGCGCAAGCGGAATGACTCGGAGGAGGAGGAGCGAGAGCGCGATGAGGAGCAGGAGCCGCCGCCGTTGTTGCCGCCGCCCGGCACTGGAGAAGAGCCGGGCCCCGGCGGCAGCGACAGGGCCCCCGGGGGAGAGTCGCTACTGGGCCCCGGGCTGCCACCGCCTTCTGCACTGACCCCAGGGCCCGGGGCCGAGGCCGGGAGCTGCTTCCCGGGCGGCGCGGAACCTGGCAACGGGCTGAAGCAGCGCAAGAGGCCGCGCGAGAACAAAGAAGTGCCCCGGGCCAGCCTGCTCAGCTTCCAGGACGAGGAGGAAGAAAATGAAGAAGTTTTTAAAGTGAAGAAATCAAGTTATAGCAAAAAGATTGTAAAATTACTTAAGAAAGAATATAAAGAAGATCTTGAAAAATCAAAGATTAAGACAGATGTCAACTCATCAGCTGACAATGAACCACCTTTGGACAAAACAGGACATGTTAAGGACACCAGTCAAGAAGATGGAGTTATTATTAGTGAACATGGTGAAGATGAAATGGATATGGAAAGTGAGAAGGAAGAAGAAAAGCCCAAGGCTGGGGGAGCCTTTTCAAATGCTTTATCTTCTTTGAATGTTCTCCGTCCAGGAGAAATTCCAGATGCAGCTTTCATACATGCTGCAAGGAAAAAGCGTCAGATGGCCCGGGAATTGGGAGATTTCACTCCTCATGATAGTGAGCCTGGTAAAGGCCGCCTTGTTAGAGAAGATGAGAATGATGCCAGCGATGATGAAGATGATGATGAGAAACGCCGTATAGTATTTTCTGTGAAAGAAAAGTCTCAAAGACAAAAAATTGCCGAGGAAATAGGTATTGAGGGGAGTGACGATGATGCTTTAGTAACTGGAGAACAGGATGAAGAGCTCAGCCGATGGGAACAGGAGCAGATAAGAAAAGGAATTAATATTCCTCAGGTTCAAGCAAGTCAGCCTACTGAAGTGAATATGTACTACCAGAACACTTACCAGACAATGCCTTACGGTTCATCCTATGGCATTCCTTATAGTTATACAGCCTATGGATCATCCGATGCCAAATCTCAAAAATCAGATAATACAGTCCCTTTCAAAACTCCCAGTAATGAGATGACTCCCGTTACTATTGATTTGGTAAAGAAACAGCTTAAAGACAGGTTGGACTCCATGAAAGAACTACACAAAACAAATCGACAGCAGCATGAGAAACATCTGCAAAGCCGAGTGGACTCTACCAGGGCTATTGAAAGATTAGAAGGGTCTTCTGGGGGTATTGGTGAACGGTATAAATTTTTGCAAGAAATGCGAGGGTATGTCCAAGACTTGCTTGAGTGTTTCAGTGAAAAGGTGCCACTGATTAATGAACTTGAATCAGCATTACATCAGCTGTACAAACAGCGAGCTTCCCGCCTTGTCCAAAGACGACAAGATGATATTAAAGATGAATCTTCGGAGTTTTCAAGCCATTCAAGTCAGTCCATCTTGAAGATAAAGCTCTGATGGCACCAAATCTTGATTCTTTTGGACGAGATCGGGCACTGTATCAAGAACACGCGAAACGTCGGATTGCAGAACGGGAGGCCAGGAGGACTCGGCGTCGACAAGCCAGAGAGCAAACCGGTAAGATGGCAGATCACCTCGAAGGCCTTTCCAGTGATGATGAAGAAACGTCTACAGATATTACAAATTTCAACCTGGAAAAAGATCGCATTTCAAAAGAGTCCAGCAAGGTTTTTGAAGATGTCCTTGAGAGCTTCTATTCAATTGACTGTATTAAATCTCAATTTGAAGCATGGCGTTCAAAATACTACATGTCCTACAAGGATGCTTACATTGGCCTTTGTTTGCCAAAGTTGTTCAACCCCCTCATAAGGCTGCAGCTTCTCACTTGGACTCCTCTTGAGGCAAAATGTCGTGACTTTGAAAATATGCTGTGGTTTGAATCTTTGCTGTTTTATGGTTGCGAAGAACGAGAGCAAGAAAAAGATGACGTGGATGTCGCACTATTACCTACTATTGTGGAAAAGGTGATTCTTCCAAAACTAACAGTGATAGCTGAAAATATGTGGGATCCTTTTTCTACAACACAGACTTCACGAATGGTTGGAATTACGTTAAAATTAATAAATGGATATCCTTCAGTAGTGAACGCAGAAAACAAAAATACACAGGTGTACCTAAAAGCACTTTTATTGAGAATGCGAAGAACTTTAGATGATGATGTATTCATGCCCTTATATCCCAAAAATGTCTTAGAAAATAAAAATTCTGGGCCTTATTTGTTTTTTCAACGACAGTTTTGGTCTTCAGTTAAGCTATTAGGGAATTTTCTTCAATGGTACGGCATTTTCTCAAATAAAACTCTTCAGGAGTTATCAATAGATGGTTTATTAAATAGATACATTCTCATGGCTTTTCAGAATTCAGAATATGGAGATGACAGCATCAAAAAAGCCCAAAATGTAATCAATTGTTTCCCCAAGCAGTGGTTCATGAACCTGAAAGGAGAAAGAACTATTTCTCAGTTAGAAAACTTCTGTCGGTACCTTGTGCACTTAGCAGATACAATTTACAGAAACAGCATTGGGTGCTCTGATGTGGAAAAAAGAAACGCAAGGGAAAACATAAAACAGATAGTAAAACTCCTTGCAAGTGTTCGAGCTCTGGATCATGCTATGTCTGTTGCAAGTGACCATAATGTGAAAGAATTTAAGTCTTTGATTGAAGGAAAATAGATCTATGAGACTGAAAAGCCTATTTGCTTTAATATCATTCCCAATGTATAAATTTTGTATATATGTAAAGTTTCTTAAACTGTAAAATACTGATTCTCGTTTTAATACAAAGAACATTATTAATATTCAATACTGTGTCCTTAAATGCAATTTCTTCGGAATGAAAGGAATTTAGATTATTTCTAGGAAGTTTATGAATGTTTTCCTTACTGCCTGTCATACTTTGTTTACAGACGTATTTTATATAGTCATTCAAATTAACTCGCTCAATTAATTGTTCTCTGTAAACGATGTGTGCAGTGTAAATTGTGTAATTATGCATATATATATTTATACCACCATGGCGTTACTTTCACACTGGAAATTTGTGATGTTTTTCTACAGAGTAAGCCTTTTAACAGCAGAAAATTATTCAGTAGCAAATTGTCTTAGGGAAATTACTACACTGTTGCAACAAAAGGGCTGGCAAGTGACTAAGTGTTCATCACCTTTTGGTTAGCAGTTGCTGTCACTGTCGCTGTGCTGCCTTAAACTTGAGAGTTGAGTGTGGACTTGATCAGTGGGTGAATGGTGAACTTTCTTCCTTGAATCAGCATGACAGTCAAATGTGGGTTTAATGTGAACTCTAATATATGCAACATAAGTTTTTGAAAAGAACATAGGAGTTTAATTTTTGGAAATAGACCCACAACCTAACTGTATGGTTTGGGGCTGACTGTCCTGTCTCATTCATGATTTTATTCCCTGACCAGCTTACAAATACGTGCATTTGAATTTTAGCATCCCGTCATTATATTTAAAATCCCACATATGTGAGTTATATATGCAATAAAGAATACGCCTTGCTGATCAGCCACACCCAAGCAATTTAATATCCGTGGTCTTCTATAATGTTTATACCACATTGTAAATATTCAGAGAACTTGTTTTAAAGTTTATGCTTTCTGATTCTGTGATTTTCAAAAGAGGAATTTTTGGAAATTAAGGACTATTATTTGATAATTATATATGTAATTAAGCTTTAGCCAAGCATTAAATTAATTTTCAATTATA