Transcript asmbl_60017

Sequence
Transcript Sequence for observation asmbl_60017 of TGE0006507:
GCCGTCGCGAGCTCGGCGCTGCCGGGCAGCCGTGTGGGAGCGGGTGTGAGACCGCCGTGCGGGCCGCGGGAATGTTCCGAAAGGCCCGGCGAGTGAACGTGCGCAAGCGGAATGACTCGGAGGAGGAGGAGCGAGAGCGCGATGAGGAGCAGGAGCCGCCGCCGTTGTTGCCGCCGCCCGGCACTGGAGAAGAGCCGGGCCCCGGCGGCAGCGACAGGGCCCCCGGGGGAGAGTCGCTACTGGGCCCCGGGCTGCCACCGCCTTCTGCACTGACCCCAGGGCCCGGGGCCGAGGCCGGGAGCTGCTTCCCGGGCGGCGCGGAACCTGGCAACGGGCTGAAGCAGCGCAAGAGGCCGCGCGAGAACAAAGAAGTGCCCCGGGCCAGCCTGCTCAGCTTCCAGGACGAGGAGGAAGAAAATGAAGAAGTTTTTAAAGTGAAGAAATCAAGTTATAGCAAAAAGATTGTAAAATTACTTAAGAAAGAATATAAAGAAGATCTTGAAAAATCAAAGATTAAGACAGATGTCAACTCATCAGCTGACAATGAACCACCTTTGGACAAAACAGGACATGTTAAGGACACCAGTCAAGAAGATGGAGTTATTATTAGTGAACATGGTGAAGATGAAATGGATATGGAAAGTGAGAAGGAAGAAGAAAAGCCCAAGGCTGGGGGAGCCTTTTCAAATGCTTTATCTTCTTTGAATGTTCTCCGTCCAGGAGAAATTCCAGATGCAGCTTTCATACATGCTGCAAGGAAAAAGCGTCAGATGGCCCGGGAATTGGGAGATTTCACTCCTCATGATAGTGAGCCTGGTAAAGGCCGCCTTGTTAGAGAAGATGAGAATGATGCCAGCGATGATGAAGATGATGATGAGAAACGCCGTATAGTATTTTCTGTGAAAGAAAAGTCTCAAAGACAAAAAATTGCCGAGGAAATAGGTATTGAGGGGAGTGACGATGATGCTTTAGTAACTGGAGAACAGGATGAAGAGCTCAGCCGATGGGAACAGGAGCAGATAAGAAAAGGAATTAATATTCCTCAGGTTCAAGCAAGTCAGCCTACTGAAGTGAATATGTACTACCAGAACACTTACCAGACAATGCCTTACGGTTCATCCTATGGCATTCCTTATAGTTATACAGCCTATGGATCATCCGATGCCAAATCTCAAAAATCAGATAATACAGTCCCTTTCAAAACTCCCAGTAATGAGATGACTCCCGTTACTATTGATTTGGTAAAGAAACAGCTTAAAGACAGGTAGGGCAGATCAATGTCTTAAAGACCTGTCCTCTAGCTTTGTGTTCCCTCAGGCAACATGTAGTCTGGGGTAGCAGATGCAGACTATCAGCAAAGAAGATTCACTGGCCCATCTTCAAAAGCTAAACAGAAGATGACTTCATCCTTTGTTCTGCTACCTGCTTGGATTACTTCTGTGGAAGCCTTGAAAAGTTTTTTAGAATGCCACTCCATGATCTTGTTGAAGACAGTTCTGAGTTTGCACCTCTTGGACTCTGAAAAAGTGTAGTCAAGATATGGGGGGAAAAGCAAAACAGTGAGATTTTGGTTAGCCCATCAAAAAACTTTATATGAAGTCTGTAAACTGCCAATTTTTTGAGAAAAAAGCAGTACAGATGAAAAGATGCCACACCAAGTATTTTTATATTCTAATAGTGGAACTAAATGCGTTATAATATTGCAAGAGTCCTGACAGCATAAATTTTGTGGTGTAAATATGTTATATTTATCCTTTTGTGTTCTTAAGGTTGGACTCCATGAAAGAACTACACAAAACAAATCGACAGCAGCATGAGAAACATCTGCAAAGCCGAGTGGACTCTACCAGGGCTATTGAAAGATTAGAAGGGTCTTCTGGGGGTATTGGTGAACGGTATAAATTTTTGCAAGAAATGCGAGGGTATGTCCAAGACTTGCTTGAGTGTTTCAGTGAAAAGGTGCCACTGATTAATGAACTTGAATCAGCATTACATCAGCTGTACAAACAGCGAGCTTCCCGCCTTGTCCAAAGACGACAAGATGATATTAAAGATGAATCTTCGGAGTTTTCAAGCCATTCAAGTCAGTCCATCTTGAAGATAAAGCTCTGATGGCACCAAATCTTGATTCTTTTGGACGAGATCGGGCACTGTATCAAGAACACGCGAAACGTCGGATTGCAGAACGGGAGGCCAGGAGGACTCGGCGTCGACAAGCCAGAGAGCAAACCGGTAAGATGGCAGATCACCTCGAAGGCCTTTCCAGTGATGATGAAGAAACGTCTACAGATATTACAAATTTCAACCTGGAAAAAGATCGCATTTCAAAAGAGTCCAGCAAGGTTTTTGAAGATGTCCTTGAGAGCTTCTATTCAATTGACTGTATTAAATCTCAATTTGAAGCATGGCGTTCAAAATACTACATGTCCTACAAGGATGCTTACATTGGCCTTTGTTTGCCAAAGTTGTTCAACCCCCTCATAAGGCTGCAGCTTCTCACTTGGACTCCTCTTGAGGCAAAATGTCGTGACTTTGAAAATATGCTGTGGTTTGAATCTTTGCTGTTTTATGGTTGCGAAGAACGAGAGCAAGAAAAAGATGACGTGGATGTCGCACTATTACCTACTATTGTGGAAAAGGTGATTCTTCCAAAACTAACAGTGATAGCTGAAAATATGTGGGATCCTTTTTCTACAACACAGACTTCACGAATGGTTGGAATTACGTTAAAATTAATAAATGGATATCCTTCAGTAGTGAACGCAGAAAACAAAAATACACAGGTGTACCTAAAAGCACTTTTATTGAGAATGCGAAGAACTTTAGATGATGATGTATTCATGCCCTTATATCCCAAAAATGTCTTAGAAAATAAAAATTCTGGGCCTTATTTGTTTTTTCAACGACAGTTTTGGTCTTCAGTTAAGCTATTAGGGAATTTTCTTCAATGGTACGGCATTTTCTCAAATAAAACTCTTCAGGAGTTATCAATAGATGGTTTATTAAATAGATACATTCTCATGGCTTTTCAGAATTCAGAATATGGAGATGACAGCATCAAAAAAGCCCAAAATGTAATCAATTGTTTCCCCAAGCAGTGGTTCATGAACCTGAAAGGAGAAAGAACTATTTCTCAGTTAGAAAACTTCTGTCGGTACCTTGTGCACTTAGCAGATACAATTTACAGAAACAGCATTGGGTGCTCTGATGTGGAAAAAAGAAACGCAAGGGAAAACATAAAACAGATAGTAAAACTCCTTGCAAGTGTTCGAGCTCTGGATCATGCTATGTCTGTTGCAAGTGACCATAATGTGAAAGAATTTAAGTCTTTGATTGAAGGAAAATAGATCTATGAGACTGAAAAGCCTATTTGCTTTAATATCATTCCCAATGTATAAATTTTGTATATATGTAAAGTTTCTTAAACTGTAAAATACTGATTCTCGTTTTAATACAAAGAACATTATTAATATTCAATACTGTGTCCTTAAATGCAATTTCTTCGGAATGAAAGGAATTTAGATTATTTCTAGGAAGTTTATGAATGTTTTCCTTACTGCCTGTCATACTTTGTTTACAGACGTATTTTATATAGTCATTCAAATTAACTCGCTCAATTAATTGTTCTCTGTAAACGATGTGTGCAGTGTAAATTGTGTAATTATGCATATATATATTTATACCACCATGGCGTTACTTTCACACTGGAAATTTGTGATGTTTTTCTACAGAGTAAGCCTTTTAACAGCAGAAAATTATTCAGTAGCAAATTGTCTTAGGGAAATTACTACACTGTTGCAACAAAAGGGCTGGCAAGTGACTAAGTGTTCATCACCTTTTGGTTAGCAGTTGCTGTCACTGTCGCTGTGCTGCCTTAAACTTGAGAGTTGAGTGTGGACTTGATCAGTGGGTGAATGGTGAACTTTCTTCCTTGAATCAGCATGACAGTCAAATGTGGGTTTAATGTGAACTCTAATATATGCAACATAAGTTTTTGAAAAGAACATAGGAGTTTAATTTTTGGAAATAGACCCACAACCTAACTGTATGGTTTGGGGCTGACTGTCCTGTCTCATTCATGATTTTATTCCCTGACCAGCTTACAAATACGTGCATTTGAATTTTAGCATCCCGTCATTATATTTAAAATCCCACATATGTGAGTTATATATGCAATAAAGAATACGCCTTGCTGATCAGCCACACCCAAGCAATTTAATATCCGTGGTCTTCTATAATGTTTATACCACATTGTAAATATTCAGAGAACTTGTTTTAAAGTTTATGCTTTCTGATTCTGTGATTTTCAAAAGAGGAATTTTTGGAAATTAAGGACTATTATTTGATAATTATATATGTAATTAAGCTTTAGCCAAGCATTAAATTAATTTTCAATTATA