Transcript asmbl_36821

Sequence
Transcript Sequence for observation asmbl_36821 of TGE0001625:
GGGGCCATTTCCGCTGCTGCTTCTGTGAGTTTTTCCGGTGCACGCGAGTGCTTCTGAAACGTCAGCTGCGCTCCCCTAGGAGTGCTGAGCCCGCGGAACCGCAGCCATGACTGAGGCTGATGTGAATCCAAAGGCCTATCCCCTTGCCGATGCCCACCTCACCAAGAAGCTACTGGACCTCGTTCAGCAGTCATGTAACTATAAGCAGCTTCGGAAAGGAGCCAATGAGGCCACCAAAACCCTCAACAGGGGCATCTCTGAGTTCATCGTGATGGCTGCAGACGCCGAGCCACTGGAGATCATTCTGCACCTGCCGCTGCTGTGTGAAGACAAGAATGTGCCCTACGTGTTTGTGCGCTCCAAGCAGGCCCTGGGGAGAGCCTGTGGGGTCTCCAGGCCTGTCATCGCCTGTTCTGTCACCATCAAAGAAGGCTCGCAGCTGAAACAGCAGATCCAATCCATTCAGCAGTCCATTGAAAGGCTCTTAGTCTAAACCTGTGGCCTCTGCCACGTGCTCCCTGCCAGCTTCCCCCCTGAGGTTGTGTATCATATTATCTGTGTTAGCATGTAGTATTTTCAGCTACTCTCTATTGTTATAAAATGTAGTACTAAATCTGGTTTCTGGATTTTTGTGTTGTTTTTGTTCTGTTTTACAGGGTTGCTATCCCCCTTCCTTTCCTCCCTCCCTCTGCCATCCTTCATCCTTTTATCCTCCCTTTTTGGAACAAGTGTTCAGAGCAGACAGAAGCAGGGTGGTGGCACCGTTGAAAGGCAGAAAGAGCCAGGAGAAAGCTGATGGAGCCAGGACAGAGATCTGGTTCCAGCTTTCAGCCACTAGCTTCCTGTTGTGTGCGGGGTGTGGTGGAATTAAACAGCATTCATTGTGTGTCCCTGTGCCTGGCACACAGAATCATTCATACGTGTTCAAGTGATCAAGGGGTTTCATTTGCTCTTGGGGGATTAGGTATCATTTGGGGAGGAAGCATGTGTTCTGTGAGGTTGTTCGGCTATGTCCAAGTGTCGTTTACTAATGTACCCCTGCTGTTTGCTTTTGGTAATGTGATGTTGATGTTCTCCCCCTACCCACAACCATGCCCTTGAGGGTAGCAGGGCAGCAGCATACCAAAGAGATGTGCTGCAGGACTCCGGAGGCAGCCTGGGTGGGTGAGCCATGGGGCAGTTGACCTGGGTCTTGAAAGAGTCGGGAGTGACAAGCTCAGAGAGCATGAACTGATGCTGGCATGAAGGATTCCAGGAAGATCATGGAGACCTGGCTGGTAGCTGTAACAGAGATGGTGGAGTCCAAGGAAACAGCCTGTCTCTGGTGAATGGGACTTTCTTTGGTGGACACTTGGCACCAGCTCTGAGAGCCCTTCCCCTGTGTCCTGCCACCATGTGGGTCAGATGTACTCTCTGTCACATGAGGAGAGTGCTAGTTCATGTGTTCTCCATTCTTGTGAGCATCCTAATAAATCTGTTCCATTTTGATGACAGAA