Transcript asmbl_59063

Sequence
Transcript Sequence for observation asmbl_59063 of TGE0006453:
GTTTAGGCCTGAGGTAGAGTCGCTGCTTTTTTGGTAAACACCTTTGGAGACTCCTGGGCAACAGGGAGATAATCCCCTATGTTGGGACCATCCCTGAACAGTTGGAGCCTGGAACTTTGATTGTGATACGTGGGCATGTTCCTGGTGACTCGGACAGATTCCAGGTGGACCTCCAGAATGGCAGCAGTGTGAAGCCTCGGGCTGACGTGGTCTTTCATTTCAACCCACGTTTCAAAAGGTCCAACTGCATTGTTTGCAATACTCTGAAAAATGAGAGATGGGGACGGGAAGAGATCACCTACGACATGCCTTTCAAGAAAGAAAAGTCTTTTGAAATTGTGATTCTGGTGCTGGAAGACAAATTCCAGGTGGCCGTGAATGGGAAGCACGTCCTGCTCTACGCGCACAGGATGCGCCCGGAGGAAGTGGACACACTGGGCATTTACGGCAAAGTGCACATCCACTCTGTGGGCTTCAGCTTCAGCTCGGATTTAGGAAGTACCCAAGCATCTACTCTGGAACTGACAGAGATAAGTAAAGAAAATGCTTCCCAGTGCTGACAGCGGTTTCTTTTCAGACGCTGCCATTTGTCGCAAGGCTGAACTCTTCCATGGGTCCCGGACGGACTGTCGTCATCAAAGGAGAAGTGAACACAAACGCCAAAGGCTTTAATGTCGATCTACTCTCAGGAAAATCGAAGGATATTGCCCTCCACCTGAACCCACGCCTGAACGTTAAAGCATTTGTGAGAAATTCTTTTCTTCAGGAGGCCTGGGGAGAAGAAGAGAGAAATATTACCTGTTTCCCATTTAGTCCTGGGATGTATTTTGAGATGATAATTTATTGTGATGTTAAAGAATTCAAGGTTGCGATAAACGGCGTGCACAGCCTGGAGTACAAACACCGGTTCCTGGAGCTCACCAGTATCGACACGCTGGAAGTCGACGGAGACATCCACTTACTGGAAGTAAGGAGCTGGTAGCTGACGTGAATTGCCTCAAAAACTGAAATACAAAATGGCTTATGTAACACTGGCTTTGTTAAAATGCATCTCAGTATTATCATGTTTATATGTTAAATGAGCTTATAGCAGTTATACTGGGTGTTCCGTCCTAGTAGGTAGTGTGGCTCTGTGAGGCACAGGCGGAAGAAATTTGAAGCAACAGAAGCGTACAGCCATTGCTGAGGCCTTCCTCGCCCCCTGGCCTCGTCTGGAGCCCACTTCCCACTGAACAAGCACTTACGCGGCGCCTGCTCTCACAGCCTCAACGCGCCAAGCACATCCCTTTGCCAGCACCGTGCTGGGGGCCGGGGTGCACGCACGGTGGTGCCCTGGACTGTGCTCCCCGTTCTCTTGAGCTCAGAATCCTGTGTGCTCTGCCCTGTGCACTGTTTCTTCTGCAGGTATCGCATACTCACCAGGGACTTAGAACTGCTCAGCTGTTAAATCACCTAGAAACTAATTCAAAGACAGTACTCTGGCCCCAGTGGTCACACTCAGCGTCATATCTCATAGCTAAGGGGTCGATTTTGACTCCCATCTGGCACTTTCCTTTAGCATAATAAATATCTAGCCCTACTAGCTGTAAGCATTACCAAGTAGTGAACACTATGAAGTCTGAACACAGCACAAAAATTAAGGCAAAAGAATAATCAAGCAAAACAAAAACGAATGTATTGAAATTAACCTGATCTCATTCGCAAGGCCACTGATTTCCGTATCAGTAAATGGTTATTTTAGAACATGTGAATTTAGGTTGAGTCAAAGGTCTGCACGTGCCTCTACAGAAGGTTTAAGGTGGAAGAGGATTTCCATTAGTACAATGTTTATAGGTGACAAAGCATAGCCAAGGTCTGGTTTAATGGCTGCTTCTGAAAGAGGCACGATCGGAAAGTGAAATGCAGCCACTGAGGGCAGGGAGGAGCGTGCGCACCCGTCCTCCGCACGCGAACCAGCACCGCCTCTGCTCTTCCCAGGGATAGTCCATCACGTTAGCGACCGAGATCAAAACATTATTCTACTTTAAGTGATTAAAATCAAACCT