Transcript asmbl_59062

Sequence
Transcript Sequence for observation asmbl_59062 of TGE0006454:
GTTTAGGCCTGAGGTAGAGTCGCTGCTTTTTTGGTAAACACCTTTGGAGACTCCTGGGCAACAGGGAGATAATCCCCTATGTTGGGACCATCCCTGAACAGTTGGAGCCTGGAACTTTGATTGTGATACGTGGGCATGTTCCTGGTGACTCGGACAGATTCCAGGTGGACCTCCAGAATGGCAGCAGTGTGAAGCCTCGGGCTGACGTGGTCTTTCATTTCAACCCACGTTTCAAAAGGTCCAACTGCATTGTTTGCAATACTCTGAAAAATGAGAGATGGGGACGGGAAGAGATCACCTACGACATGCCTTTCAAGAAAGAAAAGTCTTTTGAAATTGTGATTCTGGTGCTGGAAGACAAATTCCAGGTGGCCGTGAATGGGAAGCACGTCCTGCTCTACGCGCACAGGATGCGCCCGGAGGAAGTGGACACACTGGGCATTTACGGCAAAGTGCACATCCACTCTGTGGGCTTCAGCTTCAGCTCGGATTTAGGAAGTACCCAAGCATCTACTCTGGAACTGACAGAGATAAGTAAAGAAAATGTAAACAGTGCTACACTGCCAGGGACCCCTCTGGGACCAAGGCAGATGCAGCCTATCCCCTGTGAGGTTTACAAGGTCAACGGCCCCAGCATTTGGCCAGTTGTCCCATGCGATCCCATTCTGCAGGCTTCCCAGTGCTGACAGCGGTTTCTTTTCAGACGCTGCCATTTGTCGCAAGGCTGAACTCTTCCATGGGTCCCGGACGGACTGTCGTCATCAAAGGAGAAGTGAACACAAACGCCAAAGGCTTTAATGTCGATCTACTCTCAGGAAAATCGAAGGATATTGCCCTCCACCTGAACCCACGCCTGAACGTTAAAGCATTTGTGAGAAATTCTTTTCTTCAGGAGGCCTGGGGAGAAGAAGAGAGAAATATTACCTGTTTCCCATTTAGTCCTGGGATGTATTTTGAGATGATAATTTATTGTGATGTTAAAGAATTCAAGGTTGCGATAAACGGCGTGCACAGCCTGGAGTACAAACACCGGTTCCTGGAGCTCACCAGTATCGACACGCTGGAAGTCGACGGAGACATCCACTTACTGGAAGTAAGGAGCTGGTAGCTGACGTGAATTGCCTCAAAAACTGAAATACAAAATGGCTTATGTAACACTGGCTTTGTTAAAATGCATCTCAGTATTATCATGTTTATATGTTAAATGAGCTTATAGCAGTTATACTGGGTGTTCCGTCCTAGTAGGTAGTGTGGCTCTGTGAGGCACAGGCGGAAGAAATTTGAAGCAACAGAAGCGTACAGCCATTGCTGAGGCCTTCCTCGCCCCCTGGCCTCGTCTGGAGCCCACTTCCCACTGAACAAGCACTTACGCGGCGCCTGCTCTCACAGCCTCAACGCGCCAAGCACATCCCTTTGCCAGCACCGTGCTGGGGGCCGGGGTGCACGCACGGTGGTGCCCTGGACTGTGCTCCCCGTTCTCTTGAGCTCAGAATCCTGTGTGCTCTGCCCTGTGCACTGTTTCTTCTGCAGGTATCGCATACTCACCAGGGACTTAGAACTGCTCAGCTGTTAAATCACCTAGAAACTAATTCAAAGACAGTACTCTGGCCCCAGTGGTCACACTCAGCGTCATATCTCATAGCTAAGGGGTCGATTTTGACTCCCATCTGGCACTTTCCTTTAGCATAATAAATATCTAGCCCTACTAGCTGTAAGCATTACCAAGTAGTGAACACTATGAAGTCTGAACACAGCACAAAAATTAAGGCAAAAGAATAATCAAGCAAAACAAAAACGAATGTATTGAAATTAACCTGATCTCATTCGCAAGGCCACTGATTTCCGTATCAGTAAATGGTTATTTTAGAACATGTGAATTTAGGTTGAGTCAAAGGTCTGCACGTGCCTCTACAGAAGGTTTAAGGTGGAAGAGGATTTCCATTAGTACAATGTTTATAGGTGACAAAGCATAGCCAAGGTCTGGTTTAATGGCTGCTTCTGAAAGAGGCACGATCGGAAAGTGAAATGCAGCCACTGAGGGCAGGGAGGAGCGTGCGCACCCGTCCTCCGCACGCGAACCAGCACCGCCTCTGCTCTTCCCAGGGATAGTCCATCACGTTAGCGACCGAGATCAAAACATTATTCTACTTTAAGTGATTAAAATCAAACCT