Transcript asmbl_13451

Sequence
Transcript Sequence for observation asmbl_13451 of TGE0000158:
ACTTCCTGCTCATCTGCCGCTCCCTTTGCCGCCGCCTTAGCCCGGGACCCGAACCCAGCCTCTCCCCTACCCGAACACCGGCCCCGGCTCCACCGAGGCCCGGGTCCCCCAGCCCGTCTCGCCGCCGCCATGGCGGACCCTAAATACGCCGACCTTCCCGGCATTGCCAGGAATGAGCCAGATGTTTATGAAACTAGCGACCTACCTGAGGATGATCAAGCGGAGTTCGATGCGGAGGAGCTGACAAGCACAAGTGTGGAACACATCATTGTCAATCCTAATGCTGCCTATGACAAGTTCAAGGACAAGAGAGTGGGGACAAAGGGACTTGATTTCTCAGATCGTATTGGAAAAACCAAGAGGACAGGATATGAATCTGGAGAATATGAGATGCTTGGAGAGGGTCTGGGAGTGAAGGAGACACCCCAGCAAAAGTACCAGCGCCTACTGCATGAGGTCCAAGAGCTGACAACTGAAGTTGAAAAAATCAAGACGACAGTGAAGGAGTCAGCCACAGAGGAGAAGCTGACCCCTGTGTTGCTGGCTAAACAGCTGGCAGCCCTGAAGCAGCAGCTGGTTGCTTCCCACCTGGAGAAGCTGCTGGGACCAGATGCTGCAATCAACCTTACCGACCCCGATGGCGCCCTGGCTAAGCGCCTACTACTGCAGCTGGAAGCAACAAAGAACAGCAAAGGGGGATCAGGGGGAAAAACCACTGGGACCCCCCCAGATAGCAGCCTTGTCACTTATGAACTACATTCTCGGCCTGAGCAGGACAAGTTCTCTCAAGCTGCCAAAGTCGCAGAACTTGAAAAGCGCCTGACAGAGCTGGAGACAGCTGTACGTTGTGATCAGGATGCTCAGAATCCCCTTTCTGCAGGTCTACAGGGAGCCTGTCTCATGGAGACTGTAGAGCTGTTGCAAGCAAAGGTGAGCGCCCTAGACCTTGCAGTTTTGGATCAAGTGGAGGCTCGGCTACAGAGTGTCCTGGGAAAGGTGAACGAGATTGCCAAGCATAAAGCCTCTGTAGAAGATGCAGATACACAAAGCAAGGTGCACCAGCTATATGAAACTATACAGCGCTGGAGCCCCATTGCCTCCACCCTCCCTGAGCTGGTGCAGAGACTTGTCACCATCAAGCAGCTGCACGAGCAAGCCATGCAGTTTGGTCAGCTCCTGACACACTTGGATACCACCCAGCAGATGATTGCTAATTCCTTGAAGGACAATACCACCCTCTTGACCCAGGTGCAGACAACCATGCGTGAAAACCTGGCCACAGTTGAGGGGAACTTTGCCAGCATTGATGAACGGATGAAGAAGCTGGGAAAGTGAGCACATTTGGGAGCTGGAGAACAGGGGTTATCCCTACCCCTGTGAACTCTGTTAACAGCTTACATAGGGTTTCCCCTTTACTATAACTCTAGCATCCCCATCCCATTTGACACTGGGGGCAAGGGTTCTTCTTGCATGTGGGGTTTATACCCCTCCCCTGATGAATACAGAGTGGTAGCTAGGGGTTGGTTATCATCAGAAGGTGGTCTCCCCTCAGGCCTGGGGGATAAGGACGTGGGCCCAGCCACATGCCAACTCATGTCCAATACTGCTTTGCCTGGTGTGGGGAAGGATTGGGTCTTGTCCCCCAACACAGCTTCTGTGGCTGACTGTAATACTGTACAACTGTTTCTGACCATTAAATGCTGTTGTACTCTGTGTGGCCTCTGCTGTGTTTCCTGGGGAGGAAGCAGCACTAGGATATAGATATTCATTCGTCATAACAGGCAATCTAAGCCACTCTATACTACAAGAGATGGATTTAAATTGTAACCTGTTCTTACCAAAGAACTAAATAAAAAATGAGTACAGAGCCAGA