Transcript asmbl_58555

Sequence
Transcript Sequence for observation asmbl_58555 of TGE0006435:
GAACATGAAACTTTCAGTTCTCCAGTTAAAAATCGAAAACTGCTTTTTTAAAACCTTTTTTCTTTTTGATTTGATTTAAAAACTGTATCCTCGCTTATTCTGCTGTCTATAACGGAAGTTTTGTAGGTTTCGCAACGGTGGTTTCACTTTTGTTAAAACGTTAAGCGGGGTGGAGTAGACTCTCTGGAATACACGATGGCGCAAAAGAAATATCTCCAAGCAAAATTGACCCAGTTTTTAAGGGAAGACAGAATTCAACTTTGGAAACCTCCATATACAGATGAAAATAAAGAAGTTAATTTGGCATTGAAGGACCTCGCTAAGAAGTACTCCGACAAGCTAGAATGTTGCGAAAATGAAGTAGAAAAAGTCATAGAAGAGATTCGTCGCAAAGCAATCGAGCGGGGCACAGGAAATGAAAATTACAAGACGACAGGGATCGCTACAATTGAGGTATTTTTACCTCCACGACTAAGGAAAGATAGGAAAACCCTGTTGGAGACCCGACTGCACATCACTGGCAAAGAACTGAGGTCTAAAATAGCTGAAACCTTTGGATTTCAAGAAAATTATATCAAAATTGTCATAAATAAGAAACAACTTCAACTAGGCAAATCGCTCGAGGAGCAGGGAGTGAAGCACAATGTGAAGGCCATGGTGCTGGAGCTGAAACAGTCCGAGGAGGACGCAAGGAAGAACTTCCAGGACGAAGAAGAAGAGCAGAATGAAGCCAAGCAGAAGGAGAAGCGAATTCAGAGGACCAAGAGAGGGCTGGAGATACTGGCGGAGAGAGCTGAGATGGTGGTGGATCCGGAAACTACACCGTACCTGGATATCGCCAACCAGACGGGCAGATCCATCGAGATCCCGTCGTCGGAAAGAAAAGCCCTTATGTTAGCGATGGGTTATCACGAGAAGGGCAGAGCGTTCCTGAAGAGGAAAGAATATGGAATAGCCTTGCCGTGTCTGCTGGACGCTGACAGATATTTCTGCGAGTGTTGCACAGAACTTCTGGATACAGTGGATAACTACGCGGTCCTCCAGCTGGATATAGTGTGGTGCTACTTCCGCTTGGAACAACTGGAATGCCTTGACGACGCAGAAAAAAAATTAAACTTGGCCCAGAAATGCTTTAAGAATTGTTATGGAGAAAATCATCAGAGACTGGTCAACATTAAAGGAAATTGTGGGAAAGAGAAGGTATTGTTTTTAAGACTTTACCTGCTTCAAGGTATCCGAAATTTTCACAGTGGGAATGGTGAAGAGGCTTCTGAGTATCTCAACAAGGCACGTCAGCTCTTTAAAGAGCTATACATCGATCCATCGAAAGTTCACAGTTTGTTGCAGTTGGGGTTTACCGCCCAGGAAGCCCGGCTTGGCCTCAGGGCCTGTGACGGGAACGTGGACCACGCAGCCACCCACATCACCAGCCGCAGAGAGGAATTGGCCCAAATAAGGAAGGAGGAAAAAGAGAAGAAGAGACTCTGCCTGGAGAACGTAAATGCCCTGAAGGGCATGGGCTACTCCACGCACGCGGCCAGGCAGGCCCTGCAGCAGGCCCGCGGGAACCTGGACGAGGCCCTGCGGATTCTTCTCAGCACCCCTCGGATGTGGTTCAGTGATTCCGACTCGGAAACCAGCAACCATCAAGAAAGTCCTTCCCAGGAAAATATCGACCAACTGGTGTACATGGGCTTCGACACGGCGGCCGCCAGGGCCGCCCTGCGGGTGTTCCGGGGGAACGTGCAGCTGGCCGCGCAGACCCTCGCGCACAACGGGGGAAGTCTCCCGCCCGGCCTGCAGCTCGCGGTGGAGGAGCCTCCGTCGACGCCCTCCACGTCCCCTTCCGACTCTGCAGGTACCTCTAGTGCCTCAACAGATGAAGATATGGAGACAGAGGCCGTCAATGAAATACTGGAAGATATTCCAGAGCACGAAGAAGATTATCTCGACTCGACTCTGGAAGACGAAGAAATTATTATTGCAGAGTACTTATCCTACGTAGAAAATATAAAGTCAGCATCAAAGAAAAACTAAATAATGAACAGAAATAAGTACTAAGTTTCTGCTTATAAATTCTATCGTTATGAAAAGTGTAATGCAGGTCTTCCTTTTTTTTCTTCTTTTCATCTGATTTTGCTCTGGAGTGCTTTCACCTTGGGTGTAGGAGGAGGGTGGGCAGGGGACAGGGACCTGGACGGTGAGAGGAGGAGACTGGGGGCGGGGGCGTGGGTGCTGGTCCTGACAGGTGATCTGAGGACGGAGCCGCCTGCGGCCTGCTCTGCCATCCCCGGCCGCCAGCCGGGTCTGCAGTGTGACGCCGCGCCCACTGGGTCCTTTCCCCGCAGAGTGAAAGGGACTGGGGAATAGGGTGGCCCTGCGGAAGGGCTTGGGGTGGCGAGTTAACGGGGAGAGCGAGCTCCCATCGGTCTCTCTTCTGCCCTCCTGGGCCCCCTGACGGGTGGGGGTGCCACTTCACTGCTGATCTTTTCCTTCTTCCCATGATGCAGCTCTGCCTTCCTGCTTCCTCCTCGCTGTCCCGCCCCGATTGTCCTTCAAATCTTCAGTCATTCCAGGTGCTTTGGGGGCATAAAGGTGAGGCGGCGGCTCCAGTGGCCATACCAAATCGTGCCCGGACACTTTCAGCCCGAAACCAGTGTTTCAAGCTCTTAGTGTAGTTAAATATGCACTTGAAATTCAGAATTTATATGTATTGAGAATTCTTCACAAAAGTAAAATCTTTTATTAAATCAGAAAGTTTTAAATGCTAACAGAAGCAACTTATTTTTAATTAGCATTTTCAGACTCTGCTATCATGTTAAACTCAACGCTGGCTAAGATACCTACCAGAGATCAAGGCATATTTTCTCCAGGTTTTGTGGGGTTTTTTTGGTACATCTATATTACAGAAGACTATTTCTAAAGATACGTGTTTGGCCTCTTAATTGGCCCGACTAACCATTCTCGTCGCGCCGTGAATGCCTCTGTAGTTGTCTATTAATCGAGAACTCATCCCAGCACCAAGACACAGCTGGTGGCGTCGGGGACAGACTGACTCAAGTACCGGATGTGTTCCCAGGACTCTTCCTGCCGTCCCGGAAGTCGCTGGACATTCCTATGACAGGGCAGATGGCTCACTGCCGTGTCCCGTCGGGGCTGGCTGAAATGCTTTGACTTTTTCACTTACTGTTTTCATGACGCTTGGACAGCAGTCCAATTGGAATGGGTGGAAATGTGATTCTTTTAAAATGGATGATTCAGAAAGAAATAAAAGGTAG