Transcript asmbl_58523

Sequence
Transcript Sequence for observation asmbl_58523 of TGE0013566:
NNNNNNNGCTGCCGCCGCTCTGCTGCAGCCGCAGCTGCAGCTCTGCAGAGCAAGGCTGGGGGCTGGGGCCGGGGCGCCCTCCCTCCCACCTTTTCCCGCCGCTATGAGCCAGGGAAGTTCGGGGGACTGGGCCCCACTCGAGCCCACCTCCGGACCCCCAGCGCCCCCCAATCCCTTCGTACATGAGTTACGTCTCTCCCGCCTCCAGAGGGTTAAGTTCTGCCTCCTGGGGGCACTGCTGGCCCCCATCCGAGTGCTTCTGGCCTTTATCGTCCTCTTTCTCCTCTGGCCCTTTGCCTGGCTGCAAGTAGCTGGTCTTACTGAGGAGCAGCTTCAGGAGCCACTTACGGGATGGAGAAAGACCGTGTGCCACAATGGGGTGCTGGGCCTCAGCCGCGTGCTCTTTTTCCTGCTGGGCTTCCTCCGGATTCGTGTTCGAGGCCAGCGCGCCTCTCGCCTTCAAGCCCCTGTCCTTGTTGCGGCCCCCCACTCTACTTTCTTTGACCCCATTGTTCTGCTTCCCTGTGACCTGCCCAAGGTCGTGTCCCGAGCTGAGAACCTTTCTGTGCCTGTCATTGGAGCCCTTCTTCGCTTCAACCAAGCCATCCTCGTATCCCGCCATGACCCAGCTTCTCGGCGCAGAGTGGTGGAGGAGGTCCGAAGGCGGGCTACCTCAGGAGGTACTGTTCTTTCCTGAAGGCACCTGTTCCAACAAGAAGGCTTTGCTTAAATTCAAACCAGGAGCCTTCATCGCAGGAGTCCCTGTGCAGCCTGTCCTCATCCGCTACCCCAACAGTCTGGACACCACCAGCTGGGCATGGAGGGGCCCTGGAGTACTCAAAGTCCTCTGGCTCACAGCCTCTCAGCCCTGCAGCATTGTGGATGTGGAGTTCCTCCCTGTGTACCACCCCAGCCCAGAAGAGAGCAGGGACCCCACCCTGTATGCCAACAATGTCCAGAGGGTTATGGCACAGGCCCTGGGCATTCCAGCCACTGAGTGTGAGTTTGTAGGGAGCTTGCCTGTGATTGTGGTGGGTCGGCTAAAGGTAGCATTGGAGCCACAGCTCTGGGAACTGGGAAAAGTACTTCGCAATGCTGGGCTGTCCCCTGGCTATGTGGACGCTGGGGCAGAGCCAGCCCGGAACCGAATGATCAGCCAGGAAGAGTTTGCCAGGCAGCTGCAGCTCTCTGACCCACAGACCGTAGCTGGTGCCTTTAACTACTTCCAGAAGGATGCCAGCGGTTTGGTGGACTTCCGAGATGTGGCCCTTGCACTGGCAGCTCTGGATGGGAGCAGGGACCTTGAGGAGCTGACTCTCCTGGCCTTTGAGCTCTTCGCCGAGGAGCAAGCAGAGGGACCTGGCCGCCTGCTGTATAGAGACGGCTTCAGCACCATCCTGCACCTGCTGCTTGGGTCACCCCGCCCAGCTGCTGCGACTTTGCATGCTGAGCTGTGCCAGGCGGGATCCGACCAAGGCCTCTCCCTCTGTCAGTTCCAGGACTTCTCCCTCCGTGACCCACTCCACGGGAAGCTCTTCAGCACCTACCTGCGCCCCTCCCAGACACCAAATGCCTCATCCCCAGGCAGCCCCACTGCTCTGGCCAATGGGACTGTGCACGTGCCCAAGCAGAAGGGCGACTGAGCGCCTCCACCTCCCCAGCTCGCATCCAGCCCACAGACTCAGGGCAGCGCCAGGGGCTGACCCTGGGCCTCACGCCCTCTCTGCTCCTGCTTGATTTTTTGTTATTGTTGTTTGTTTTATTAAGTTTGTTTTATTAAGTTGATTTTCACTTTTTGTTTGATTTTTTGTAAGAAAC