Transcript asmbl_58521

Sequence
Transcript Sequence for observation asmbl_58521 of TGE0006430:
CGGGGGTTAAAGGGGCCTCATGTCCTCTGCCCAGTCAGCAGGTCAGTCAGTAATGAACCCTCAGAAGATTCTTCTGCCTCATTTCCCCTCCATTCCATCCTTCTTCATCCTGTAGGGCCCTGGGCATTCCAGCCACTGAGTGTGAGTTTGTAGGGAGCTTGCCTGTGATTGTGGTGGGTCGGCTAAAGGTAGCATTGGAGCCACAGCTCTGGGAACTGGGAAAAGTACTTCGCAATGCTGGGCTGTCCCCTGGCTATGTGGACGCTGGGGCAGAGCCAGCCCGGAACCGAATGATCAGCCAGGAAGAGTTTGCCAGGCAGCTGCAGCTCTCTGACCCACAGACCGTAGCTGGTGCCTTTAACTACTTCCAGAAGGATGCCAGCGGTTTGGTGGACTTCCGAGATGTGGCCCTTGCACTGGCAGCTCTGGATGGGAGCAGGGACCTTGAGGAGCTGACTCTCCTGGCCTTTGAGCTCTTCGCCGAGGAGCAAGCAGAGGGACCTGGCCGCCTGCTGTATAGAGACGGCTTCAGCACCATCCTGCACCTGCTGCTTGGGTCACCCCGCCCAGCTGCTGCGACTTTGCATGCTGAGCTGTGCCAGGCGGGATCCGACCAAGGCCTCTCCCTCTGTCAGTTCCAGGACTTCTCCCTCCGTGACCCACTCCACGGGAAGCTCTTCAGCACCTACCTGCGCCCCTCCCAGACACCAAATGCCTCATCCCCAGGCAGCCCCACTGCTCTGGCCAATGGGACTGTGCACGTGCCCAAGCAGAAGGGCGACTGAGCGCCTCCACCTCCCCAGCTCGCATCCAGCCCACAGACTCAGGGCAGCGCCAGGGGCTGACCCTGGGCCTCACGCCCTCTCTGCTCCTGCTTGATTTTTTGTTATTGTTGTTTGTTTTATTAAGTTTGTTTTATTAAGTTGATTTTCACTTTTTGTTTGATTTTTTGTAAGAAAC