Transcript asmbl_36799

Sequence
Transcript Sequence for observation asmbl_36799 of TGE0001617:
GCCAAAAGAAGTAAGACAGCTTGCAGAGGATTTCCTTCGTGATTACACCCAGATCAACGTAGGCAATCTGGAGTTGAGTGCCAACCACAACATCCTCCAGATAGTGGATGTCTGCATGGAAAGTGAAAAAGACCACAAGTTGATCCAACTAATGGAAGAAATAATGGCTGAAAAGGAAAACAAAACAATAATATTTGTGGAGACAAAGAGACGCTGTGATGATCTGACTCGAAGGATGCGCAGAGATGGTTGGCCAGCTATGTGTATCCATGGAGACAAGAGTCAACCAGAAAGAGATTGGGTACTTAATGAGTTCCGTTCTGGAAAGGCACCCATCCTTATTGCTACAGATGTAGCCTCCCGTGGGCTAGATGTGGAAGATGTCAAGTTTGTGATCAACTATGACTATCCAAACAGCTCAGAGGATTATGTGCACCGTATTGGCCGAACAGCCCGTAGCACCAACAAGGGTACCGCCTATACCTTCTTCACCCCAGGGAACCTAAAACAGGCCAGAGAGCTTATCAAAGTGCTGGAAGAGGCCAATCAGGCTATCAATCCAAAACTGATGCAGCTTGTGGACCACAGAGGAGGCGGCGGAGGCGGGGGTAAGGGTGGTCGTTCTCGTTACCGGACCACTTCTTCAGCCAACAATCCCAATCTGATGTATCAGGATGAGTGTGACCGAAGGCTTCGAGGAGTCAAGGATGGTGGCCGGAGAGACTCTGCAAGCTATCGGGATCGTAGTGAAACCGATAGAGCTGGTTATGCTAATGGCAGTGGCTATGGAAGTCCAAATTCTGCCTTTGGAGCACAAGCAGGCCAATACACCTATGGTCAAGGCACCTATGGGGCAGCTGCTTATGGCACCAGTAGCTATACAGCTCAAGAATATGGTGCTGGCACTTATGGAGCTAGTAGCACCACCTCAACTGGGAGAAGTTCACAGAGCTCTAGCCAGCAGTTTAGTGGGATAGGCCGGTCTGGGCAGCAGCCACAGCCACTGATGTCACAACAGTTTGCACAGCCTCCGGGAGCTACCAATATGATAGGTTACATGGGGCAGACTGCCTACCAATACCCTCCTCCTCCTCCCCCTCCTCCTCCTTCACGTAAATGAAACCACTCAAGTGGTAGTGACTCCAGCAGACTTAATTACATTTTAAGGAACACTGTCTTTCCTTTTTTTTTCCTCTTCGCCTTTTCTTTTTTTTTCCTTTTTTCT