Transcript asmbl_58216

Sequence
Transcript Sequence for observation asmbl_58216 of TGE0006378:
GCGCGAGCTCACCTGGGCTCGCAGCCGTGCGGCGGGGCTTGACGGAGCAAAGCGTCTCAGCCGTAGCTTCCAGTTTCGTGCGGCTCGTTTCTGCGACCCGCTGTCCTCGCCAGCCCTTCCAGCGAGCTTGGCGTCCCGCGCGCGCGTCTAGGCATCACGGAGCCTGCTGCCATGAAGCCAGCGAGGACTAAGACACCCAGGAAACCTGTAGTGAAAAAAGGATCCCAAACAAGTCTTAAAGACCCAGTTGGGGTATACTGTAGGGTGCGCCCACTGAGCTTTCCTGATCACGAGTGTTGCATAGAAGTGATCAATAATACAACTGTTCAGCTTCATACTCCTGAGGGTTACAGACTCAACCGAAATGGAGACTATAAGGAGACTCAGTATTCATTTAAACAAGTATTTGGCACTCATACTACCCAGAAGGAGCTCTTCGATGTTGTGGCTAATCCCTTGGTAGATGACCTTATTCATGGCAAGAATGGTCTCCTTTTTACATATGGTGTGACGGGAAGTGGGAAAACTCACACCATGACTGGTTCTCCAGGGGAAGGAGGGCTACTTCCTCGTTGTTTGGGCATGATCTTTAACAGTATCGGGTCATTTCAAGCTAAACGATATGTTTTTAAGTGTAATGATAGGAATAGCATGGATATACAGTGTGAAGTTGATGCCTTATTAGAACGGCAGAAAAGAGAAGCCATGCCGCATCCAAAGACCCCTGCTATCAAACGACAAGCAGACCCAGAGTTTGCAGATATGATAAATTTACAAGAATTTTGCAAAGCAGAAGAGGTTGATGAAGATAGTGTCTATGGTGTATTTGTCTCTTATATTGAAATATATAATAATTACATATATGATCTATTGGAAGAAGTTTCGTTTGATCCCATAAAGCCAAAGTGGAACAGTTGCAGCACGCCCATGAGGAACACAGACTTTGTACCTCCGCAATCTAAATTGCTTCGTGAAGATAAGAACCATAACATGTATGTTGCAGGATGTACAGAAGTAGAAGTAAAATCTGTTGAGGAGGCTTTTGAAGTTTTCTGGAGAGGCCAGAAAAAGAGACGTATTGCTAACACACATTTGAATCGTGAGTCTAGCCGTTCTCATAGCGTGTTCAACATTAAATTAGTTCAAGCTCCACTGGATGCAGATGGGGATAATGTCTTACAGGAAAAAGAACAAATCACTATAAGCCAATTGTCCTTGGTAGATCTTGCTGGAAGTGAAAGAACTAACCGGACAAAAGCAGAAGGGAACAGATTACGTGAAGCTGGTAACATTAACCAGTCACTAATGACACTAAGAACATGTATGGAAGTCCTGAGAGAGAACCAAATGTATGGAACTAACAAGATGGTTCCATATCGCGATTCAAAGTTAACTCATCTATTTAAGAACTACTTTGATGGAGAAGGAAAAGTACGCATGATTGTGTGTGTGAATCCAAAGGCCGAAGATTATGAAGAAAGCTTGCAAGTCATGAGATTTGCGGAAGTGACCCAAGAAGTTGAAGTAGCAAGACCTGTAGACAAGGCAATATGTGGTTTAACGCCTGGACGGCGATTCAGGAATCATGCTCGGGCAGGTCCAGTTGAACTACTGGTTACAGAAGTGGTTTTACAGAGTTTTCCACCTTTGCCATCCTGTGAAATTTTGGATATCAATGATGAGCAGACTCTCCCGAGGCTGATTGAAGCTTTAGAGAAACGCCATCAACTACGACAAATGATGACTGATGAGTTTAACAAACAATCTGTTACTTTTAAAGCTATGTTGCAAGAATTTGACAATGGTGTTTTAAATAAAGAAAACTACATTCAAGGAAAACTAAATGAAAAAGAAAAGGTGATCTCAGGACAGAAATTGGAAATAGAACGACTGGAGAAGAAAAACAAAACTTTAGAATATAAGATTGAAATTTTAGAGAAAACAACTACTATCTATGAAGAAGATAAGCGCAATCTGCAGCAGGAACTTGAAACCCAGAATCAGAAACTTCAGCGACAGTTTTCTGACAAACGCAGACTAGAAGCCAGGTTACAAGGCATGGTGACAGAAACAACAATGAAATGGGAGAAAGAATGCGAGCGTCGAGTGGCAGCTAAACAGCTGGAGATGCAAAATAAACTCTGGGTGAAAGATGAAAAACTGAAACAACTAAAGGCTATTGTTACTGAACCCAAAACTGAAAAGCCAGAGAGACCCTCTCGGGCACGAGATCAAGAAAAAGCTCCTCAAAGATCTGTTTCTCCATCGCCAGTACCCCTTTCTAGTAACTATATTGCTCAGATTTCCAACGGCCAGCAACTCATGAGCCAGCCACAACTACATAGGCGCTCTAACTCTTGCAGCAGCATTTCTGTAGCTTCCTGTATTTCGGAGTGGGAGCAGAAAATTCCTCCGTACAACACACCTCTCAATGTCACATCCATTGCAAGGCGTAGGCAGCAGGAGCCAGGACAAAGTAAAACTTGTATCGTGTCAGACAGAAGGCGAGGGATGTACTGGACTGAAGGCAGGGAGGTGGTTCCTACATTCAGAAATGAGATAGAAATAGAAGAGGATCATTGCTGCAGGAATGTACCACCACTTCGTCTCCGACACAGACGATCACGCTCTGCAGGAGACAGATGGGTAGATCATAAGCCTGCCTCTAACGTGCAAACTGAAACAGTCATGCAGCCACATGTCCCTCATGCCATCACAGTATCTGTTGCAAATGAAAAGGCACTAGCTAAGTGTGAGAAGTACATGCTGACCCACCAGGAACTAGCCTCCGATGGGGAGATTGAAACTAAACTAATTAAGGGTGACGTTTATAAAACAAGGGGTGGTGGACAATCTGTTCAGTTTACTGATATTGAGACTTTGAAGCAAGAATCACCAACTGGTCGAAAACGGAGATCTTCCACAGTAACACCTGCCCAACCAGATGGTGCAGAGTCTGAATGGACCGATGTAGAAACAAGGTGTTCTGTGGCTGTAGAGATGAGAGCAGGGTCTCAACTGGGTCCTGGATATCAGCATCACGCACAACCCAAGCGCAAGAAGCCATGAACTGACAGTCTAATTAATGAAAGAACATTTTGTGTCAGTAATTTCTTCAAGACCATGCCAGAAGGAGTCTTCTGAGTCATCTTGTAGAAGTCCAACTTTGACTATCACAGACCTCAGATACATCATACACTGGCCTAGATCAGAGATTTCTGTCTGGTTCCAAAGACATCTAGGATTCAACAAACTTTTTATATCCCTTGCCATATTTAATATTAATAGAGAAAGACCCCCCTTTTCTCATTGCTGCATGAACTTTTTAATAATGCTATTTTTGTATATTTGTATACTTATAAACTAATTCATGCAAGTGTTTGTCTTGGGTGATTAAGGAAGAATATATCTAGATCACGCTTTATTTTTTATTGTGACTTTTCCAGCTCTTGTCTGAATATTAAGGTTTTATAAACAAAACAAATGCTGCTATTGATTAGCTGCAAGAATGCACTTTAGACATATTTGACAATTCAAACTTTCAAAATAAAGATGTCAATGACTGGCCAATACTAAAACCATTTTAAGAAGTCGTTTTGAATTTTGTATGTATATATTCACTTTCTGACACTTAGATATACCAAAAGAATTGAAATAAAAAGCACTA