Transcript asmbl_58184

Sequence
Transcript Sequence for observation asmbl_58184 of TGE0013536:
GATGTGTCTAAGTGATTACGGTTCTAGATCATAGGCTTAGAAGCCTCTATATCCTGGATGGTTTACTTGGTTATATAATTGTTTCACATTTCAGATGCAGTTGTCATTCACATCTTCGGAACAAGAGCTAGAGCGATTAAGAAAAGAAAATAAAGATATTGAAAATTTGAGACGAGAACGAGAGCATTTGGAAATGGAACTAGAGAAGGCAGAAATTGAACGATCTACCTATGTCACAGAAGTCAGAGAGTTAAAAACACAATTAAATGAAACACTCACAAAACTTCGAACTGAACAAAGTGAAAGACAGAAGGTAGCTGGTGACTTGCATAAGGCTCAACAGTCACTGGATCTTATCCAGTCAAAAATAGTAAAAGCTGCTGGAGATACTACTGTTATTGAAAATAGTGATGTTTCCTCAGAAATGGAATCTTCTGAGAAGGAGACAATGTCTGTAAGTCTAAATCAGACTGTAACACAGTTACAGCAGTTGCTTCAGGCAGTAAACCAACAACTCACAAAAGAGAAAGAACACTACCAGGTCTTAGAGTGAAGTAATTGGGGAAACCATTCAAGGATAACAGGAGGCATTGTATTATATTTTGCCAAATTAAAGCCTTATTTATGTTTTCACCCTTTCTACTTCGTCAGAAACACTGAACAGAGTTTTGTCTTTTCTAATCCTTGTTAGACTACTGATTTAAAGAGAGAGAAAAAAAGCCAACTCTGTAGACACCTTCAGAGTTTAGTTTTATAATAAAAACTGTTTGAATAATTAGACCTTTACATTCCTGAAGATAAAATAAACATGTACTCTTTTATCTTATTTTGCTCAATAAAATTGTTCAGAAGATCAAAAGTGGTAAAGACAATGTAAAATTTAACATTTTAATACTGATGTTCTACACTGTTTTACTTAACATTTTGGGGAGTAACTGCCTCTGACTTCAACTCAAGAAAACACTTTTTTGTTGCTAATGTAATCAGTTTTTGTAATGGCGTCAGCAAATAAAGGGATGCTTATTATT