Transcript asmbl_58167

Sequence
Transcript Sequence for observation asmbl_58167 of TGE0006369:
CAATGAGAGAGCCTATTACTAGTTTGCGTGCTGTGGTGTAGGGGGTGCGCTTAAGGCCCTGAAGCGCTACGCGTTCTGCTGGTTTTATCAGCATGAGCTCAATCGGTACCGGGTATGACCTGTCAGCTTCCACATTCTCTCCTGATGGAAGAGTTTTTCAAGTTGAGTATGCGATGAAAGCTGTGGAAAATAGTAGTACAGCTATTGGAATCAGATGTAAAGACGGTGTTGTCTTTGGGGTAGAAAAATTAGTCCTTTCTAAACTTTATGAAGAAGGTTCCAACAAACGACTTTTTAATGTTGATCGGCATGTTGGAATGGCAGTAGCAGGTTTGCTGGCAGATGCTCGTTCTTTAGCTGACATTGCAAGAGAAGAAGCTTCCAACTTCAGATCTAACTTTGGCTATAACATTCCACTAAAACATCTTGCAGACAGAGTGGCCATGTATGTACATGCATATACACTCTACAGTGCTGTTAGACCTTTTGGCTGCAGTTTCATGTTAGGATCTTACAGTGTGAATGACGGTGCACAACTCTACATGATTGACCCATCAGGTGTTTCATATGGTTATTGGGGCTGTGCTATCGGCAAAGCCAGGCAAGCTGCAAAGACAGAAATAGAAAAGCTTCAGATGAAAGAAATGACCTGCCGTGATGTTGTTAAAGAAGTTGCAAAAATAATTTACATAGTACACGATGAAGTTAAGGATAAAGCTTTTGAACTAGAGCTCAGCTGGGTTGGAGAAATAACTAAAGGAAGACATGAAATTGTTCCAAAAGATATAAGGGAAGAAGCTGAAAAATACGCTAAGGAATCTTTGAAGGAAGAAGATGAATCAGATGATGACAATATGTAACACTTCTGCAGCTGTTTTAAATTTCTATTATAGTTCCCATGTAACTATTTAGCCCTGTGGATTATTACATACCTACTGACCAATTTTCATTAAAATTTTGTCTTGTAATGACTTAAGTTTGGTTACTATCTGCTTGACAAAATT