Transcript asmbl_57930

Sequence
Transcript Sequence for observation asmbl_57930 of TGE0006368:
CTTGGAGGAGGGAGATAGAGAAGAGGGAAGGAAAACGGGGAAGGGAGGAAGGAAACGAGCGAGGGGGAGGGAGGTCCCTGTTTTGGCGGAGCTGAGAGCGTTGCCGTCCTCTGAAGTGGAGCGAGAGGGAGGTGCTTTGCCGTTTCTCCTGCCGGGGGTCCCGGCTTCCCGTGGAGGCTCCGGATCAAACCCCTTCAGCTTCTCCCTCCGGATCGATGTGCTGCTGTTAACCCGTGAGGAGGCGGCGGCAGCGGAAGATGGTGTTGCTGAGAGTGTTAATTCTGCTCCTCTCCTGGGCGGCGGGGCTGGGAGGTCAGTATGGAAATCCTTTAACTAAATACATTAGACATTATGAAGGATTATCTTATGATGTGGATTCATTTCACCAAAAACACCAGCGTGCCAAAAGAGCAGTCTCACATGAGGACCAGTTTTTACGTCTAGATTTTCATGCTCATGGAAGACATTTCAACCTACGAATGAAGAGGGACACTTCCCTTTTTAGTGATGAATTTAAAGTAGAAACATCAAATACAGTACTTGATTATGATACCTCTCATATTTACACTGGACATATTTATGGTGAAGAAGGAAGTTTTAGCCATGGGTCTGTTATTGATGGAAGATTTGAAGGATTCATCCAGACTCATGGTGGCACATTTTATGTTGAGCCAGCAGAGAGATATATTAAAGACCGAAGTCTGCCTTTTCACTCTGTCATTTATCATGAAGATGATATAAACTATCCCCATAAATATGGTCCACAGGGGGGCTGTGCAGATCATTCAGTATTTGAAAGGATGAGGAAATACCAGATGACTGGTGTAGAGGAAGTAACACAGAAACATAAAGAAGAACATGCCGTTAATGGTCCAGAACTTTTGAGGAAAAAACGTACAACTTCAGCTGAAAAAAATACTTGTCAGCTTTATATTCAGACTGATCATCTGTTCTTTAAATATTATGGAACACGAGAAGCTGTGATTGCCCAGATATCCAGTCATGTTAAAGCGATCGATACAATTTATCAGACCACAGACTTCTCCGGAATCCGTAATATCAGTTTCATGGTGAAACGCATAAGAATCAATACAACTACTGATGAGAAGGACCCAACAAATCCTTTCCGTTTTCCAAATATCGGTGTGGAGAAGTTTCTGGAATTGAATTCTGAACAGAATCATGATGACTACTGTTTGGCCTATGTCTTCACCGACCGAGATTTTGATGATGGCGTTCTTGGTCTGGCTTGGGTTGGAGCACCTTCAGGAAGCTCTGGAGGAATATGTGAAAAAAGTAAGCTCTATTCAGATGGTAAGAAGAAGTCCTTAAACACTGGAATTATTACTGTGCAGAACTATGGGTCTCATGTACCCCCCAAAGTCTCTCACATTACTTTTGCTCATGAGGTTGGACATAACTTTGGATCTCCACATGATTCTGGAACAGAGTGCACTCCAGGAGAATCTAAGAATTTAGGGCAAAAAGAAAATGGCAATTACATCATGTATGCAAGAGCAACATCTGGGGACAAACTTAACAACAATAAATTCTCACTCTGTAGTATAAGAAATATAAGCCAAGTTCTTGAGAAGAAGAGAAACAACTGCTTTGTTGAATCTGGCCAACCTATTTGTGGAAATGGAATGGTAGAGCAAGGTGAAGAATGTGATTGTGGCTATAGTGACCAGTGTAAAGATGAGTGCTGCTATGATGCGAATCAGCCAGAGGGGAAAAAATGCAAGCTGAAACCCGGAAAACAGTGCAGTCCAAGTCAAGGTCCCTGTTGTACAGCACAGTGTGCATTCAAGTCAAAAACTGAAAAGTGTCGGGATGATTCAGACTGTGCAAAGGAAGGAATATGTAATGGCATTACAGCTCTCTGCCCAGCATCTGACCCTAAACCAAATTTTACAGACTGTAATAGACATACACAAGTGTGCATTAATGGACAATGTGCAGGTTCTATCTGTGAAAAATATGGCTTGGAGGAGTGTACTTGTGCCAGTTCTGATGGCAAAGATGATAAGGAATTATGCCATGTCTGCTGTATGAAGAAGATGGACCTATCAACTTGTGCCAGTACAGGGTCTGTGCAGTGGAGCAAGCAATTCATGGGTCGAACCATCACACTACAACCTGGATCCCCGTGCAATGATTTTAGAGGCTACTGTGATGTTTTCATGCGTTGCAGATTAGTAGATGCTGATGGTCCTCTAGCTAGGCTTAAAAAAGCAATTTTTAGTCCAGAGCTCTATGAAAACATTGCTGAATGGATTGTGGTTAATTGGTGGGCAGTATTACTTATGGGAATTGCCCTGATCATGTTAATGGCTGGATTTATTAAGATATGCAGTGTTCATACTCCAAGTAGTAATCCAAAGTTGCCTCCTCCTAAACCTCTTCCAGGCACTTTAAAGAGGAGGAGACCGCCACAGCCCATTCAGCAACCCCAGCGTCAGAGGCCCCGGGAGAGTTATCAAATGGGACACATGAGACGTTAACTGCAGCTTTTGCCTTGGTTCTTCCTAGTGCCTACAATGGGAAAACTTCACTCCAAAGAGACACCTATTAAATCATCCCCAAACTAAACCCTTACAACTAACAGAAGAAAAAAAAAATGGCAAGAGATCATGTCCTCAGACCAGGTGGAATTAATTAAATTTTAAAGCCTGAAAATTCCAATTTGGGGGTGGGGGGTGGAAAGGAACCCAGTTTTCTTATGGACAGATATTTTTAACCTAATGGCACAAAGTCTTAGGATATTATTATGTGCCCCGTGTTCCCTGTTCTTCGTTGCTGCATTTTCTTCACTTGCAGGCAAACTTGGCTCTGGATAAACTTTTATCACAAATTGAAATATATATATATTTTTTTCAACTGCCAGTCAAGGCTAGGAGGCTCAACCACCTCAGCATTGGAGACATCACTTGCCAATGTACATACCTTGTTATATGCAGACATGTATTTCTTACGTACACTGTACTTCTGTGTGCAATTGTAAACAGAAATTGCAATATGGATGTTCCTTTGTATTATAAAATTTTTCTGCTCTTAATGAAAAATTACTGTTTAATTGACATACTCAGGATAACAGAGAATGGTGGTATTCAGTGGTCCAGGATTCTGTAATGCTTTACACAGGCAGTTTTGAAATGAGAATCAATTTACCTTTTTCTTATGATGGAATTGGTTCTGATATTCATTTTGTCTTTATCAAATGGCTGCTAAGAGCACATGAGTGACTTCGCTGAAGAACACAAGTGTTGTGCAAACTGGACATATGCAGCATACTACTTCAGAGTTAGTTCTTTATGTAAGTGTCTGATTTCTGCTTACTTGTTTTAGACTTTCTAACTCAATTCCAGTTTTGAATTGATAGGTAAAATTTTATTCATGCTTTGGTAGAAATTATGTCAATGAAATGATTCTTTTTATTTGTAACCTCTTATTTGTTTTTTCCATATATCTAAAGTATGCTAATTATGTTTTTGGTTTTTGTGTGATATGGAAAAGAAAAGCTGTGTCTTTATTTTATCAAAATATTTGAACATTTTTTTCAGCATATCATCACTGATCATTGTTAACCACTAAAGAGTGATTTGCTCTACTTGTAGTTAAAATTGTAGGATAGGCCTTCTGACCTTTTTTCCCCTGAAATATTTTAACAACAATGGAGTTGAAACAGCACAATGTCCCATTCCAAATTTATTTTGTAAACAGATGTAAATAATTGGCTTTTTAAAGAAAGAAAGCAAAAGCATTTAATGTATTAACAGGCTTATTGCTATGCAGGAATGGAAGGGGGCATTACAAGAAAATTTTAAGCTTGTGACATATTTATTACTTGTTTTCCAGCTACATCACTTAAATGAGATGTAAACAGCTATGATTTTCCTGGCTTCACATAGGAGGCAAATTTAGGGAAAGTTGAAAAAAAGTCTGTGTTTTGGCTTCTTTTTTTCCTTTTTTTTCTTAAGAGTATAAGGTTTACACAATCATTCTCATAATGTGACGCAAGCCAGCAAGGCCAAAAATGCTAGAGAAAATAATGGGATCTCTTCCTTGTAAACTTGTACAGTATGTGGTGACTTTTTTCAGAATACAGCTTTTTGTACATGATTTAGAGACAAATTTTGTACATGAAACCCCAGATAGACTATAAATAATTCTAAACAAACAAGTAGGTAGATATGTATGTAATTGCTTTTAAATCATTTAAATGCCTTTGTTTTTGGACTGTGCAAAGGTTGGAAGTGGATTTGCATTTCTAAAATGGTGACTTTTATTCTGCAAGAGTTCTTAGTAACTTCTTGAGTGTGGTAGACTTTGGAACATGTACATTTTTTGCTTGTAATGTTATCCTGTGGTAGGGTTTTGGCAGGTACACACTGCCCTATTTTATTTTGAGTCTAAGTTAAATGTTTTCTGAAAAGAGATACGTGCACTGAACTCTCCACGGCAAATCAAGATGTGGTAAAACAAAAGGATCAAGACAAATGAGATCTAATACTACTGTCAGTTTAATGTCCACTGTGTTTTATACAGTATCTTTTTGTTCACTTTGGAAATTTTTACTAAAAATTGCAAAAAATAAAGTATTGTGCAAAGATGTAAGGTTTTTTGAAACTTGAAATGCATTAATAAATAGACTTGATGAAATCAA