Transcript asmbl_5789

Sequence
Transcript Sequence for observation asmbl_5789 of TGE0006361:
AGCAAGCGCAGTGCGCAGACTCCCCGCTGCAGTGGGCGGAGCCTCACCGGGCTCCGCCCCCTCCTTCCAGTCTCCCCTGCTCAGCTTGTTGGGGCAGAAGCTGGGGCCCCGCGGAGGTAGCAGCTGCCGCTTGCAGACTAAGGCCGAGTTTGGAGAATCTGACACACCCACTTTCCCGCCTGGGCTCTTGGTGCCCCCTGGCTGTCTGGCAAGATGAAACCTAAACTGATGTATCAGGAGCTGAAGGTGCCTGTTGAGGAGCCTGCCAGCGAGCTGCCCATGAATGAGATTGAGGCATGGAAGGCTGCGGAGAAGAAAGCCCGTTGGGTCCTGTTGGTCCTGATCCTGGCAGTTGTGGGTTTCGGTGCCCTGATGACTCAGCTGTTCTTATGGGAATACGGCGACTTGCATCTCTTTGGGCCCAACCAGCGCCCAGCCCCCTGCTATGACCCATGCGAAGCCGTGCTGGTGGAGAGCATCCCCGAGGGCCTGGACTTCCCCAATGCCTCCACGAGCAACCCCTCCACTAGCCAGGCCTGGCTGGGCCTGCTTGCTGGGGCCCACAGTAGCCTGGACATCGCCTCCTTCTACTGGACCCTCACCAACAATGACACTCACACTCAGGAGCCCTCTGCGCAACAGGGCGAGGAGGTCCTCCGGCAGCTACAGACCCTGGCGCCTCGAGGAGTGAAAGTCCGCATTGCCGTGAGCAAGCCCAGCGGGCCCCAGCCCCAGGCGGACCTGCAGGCCCTGCTGCAGAGCGGTGCCCAGGTCCGCATGGTGGACATGCAGAAGCTGACACATGGCGTCCTACACACCAAGTTCTGGGTGGTGGACCAGACCCACTTCTATATCGGCAGTGCCAACATGGACTGGCGCTCCCTGACCCAGGTCAAGGAGCTGGGCGTGGTCATGTACAACTGCAGCTGCCTAGCTCGAGACCTGACCAAGATCTTTGAGGCCTACTGGTACCTGGGCCAGGCGGGCAGCTCCATCCCATCAACCTGGCCCCGGCCCTATGACACGCGCTACAATCAAGAGACACCGATGGAGATCTGCCTCAATGGAACCCCTGCTCTGGCCTACCTGGCAAGTGCGCCTCCACCACTATGTCCAAGTGGCCGTACCCCAGACTTGAAGGCCCTGCTCAACGTGGTGGACAATGCCCGGAGTTTCATCTACATCGCAGTCATGAACTACCTGCCCACCATGGAGTTCTCCCACCCACGCAGGTTCTGGCCTGCCATCGACGATGGGCTGCGGAGGGCTGCCTACGAGCGGGGCATCAAGGTACGCCTCCTGATCAGCTGTTGGGGACACTCCGAGCCATCCATGCGGGCCTTCCTGCTCTCCCTGGCTGCCCTGCGTGACAACCACACCCACTCTGACATCCAGGTGAAACTCTTCGTGGTTCCTGCGGACGAGGCCCAGGCCCGAATCCCATATGCCCGCGTCAACCACAATAAGTACATGGTGACCGAGCGTGCCACCTACATTGGAACGTCCAACTGGTCTGGCAGCTACTTCGCAGAGACGGCGGGCACCTCGCTGCTGGTGACACAGAACGGGCGGGGTGGTCTGCGGAGCCAGCTGGAGGCCGTTTTCCTGAGGGACTGGGACTCCCCTTACAGCCATGACCTCGACACCTCAGCTGACAGCGTGGGCAACGCCTGTCGCCTGCTGTGAGGCCTGGCCCAGAGGACAGGCCGAGGCCTGCAAGGCCCCCGTGGACCCAGGAGTCCTGGGCCCTGACCCTGTCCCCATGCCCCCTGCTTCTGTCTGCCCCGTTGTGGCTCCACAGGCCCCCTGCTCTCCCACCTCTACCTCCGCCCCCACAGGCCTGACGCTGTGGCCCCAGGACCCAGCCGAGCTGGGGGAGAGATCAGCCCCCAAAGAAGTGGGGGTGCATGCTGGGCCCAGTCCCCCGGCCCACCCCCTTCCCAGGGCAAAGAGGGCCCAAGGTTATG