Transcript asmbl_56564

Sequence
Transcript Sequence for observation asmbl_56564 of TGE0006305:
ATTGCCTTAGGTGTCTAAATGCAAGTTGTGCATGGTTATCCTGAATACCACATGTCTAATACTTTCCCTTGCAACGTTAGCCAGTGTTTTTCACTGCCTCCAAAAGATTGAAATTGCTCTGGAAATTGGAAACATTTGATTTAAACGAAATAACGTTAACAAATGGACAATATGTCTATTACAAATACACCAACAAGTAATGATGCCTGTCTGAGCATTGTACATAGTTTGATGTGCCATAGACAAGGTGGAGAGAGTGAAACATTTGCAAAAAGAGCAATTGAAAGTTTGGTGAAGAAACTGAAGGAGAAAAAGGATGAATTGGATTCTTTAATAACAGCTATAACTACAAATGGAGCTCATCCTAGCAAATGTGTTACCATACAGAGAACATTGGATGGAAGGCTTCAGGTTGCCGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTCTGGAGGTGGCCTGATCTTCACAAAAATGAACTAAAACATGTTAAATATTGTCAGTATGCGTTTGACTTAAAATGTGACAGTGTCTGTGTGAATCCATATCACTATGAACGAGTTGTATCACCTGGAATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCACCAAGTATGTTGGTGAAGGATGAATATGTTCATGACTTCGAGGGACAGCCATCGTTATCCACCGAAGGGCATTCAATTCAAACCATCCAACATCCACCAAGTAATCGTGCATCAACAGAGACATACAGCACCCCAGCTCTCTTAGCTCCATCTGAGTCTAATGCTACCAGCACCACCAACTTTCCCAACATTCCTGTGGCTTCCACAAGTCAGCCTGCCAGTATACTGGCAGGCAGCCATAGTGAAGGATTGTTGCAGATAGCTTCAGGGCCTCAGCCAGGACAGCAGCAGAATGGATTTACTGGTCAGCCAGCTACTTATCATCATAACAGCACTACCACCTGGACTGGAAGTAGGACTGCACCATACACACCTAATTTGCCTCACCACCAAAACGGCCATCTTCAGCACCACCCGCCTATGCCGCCCCATCCCGGACATTACTGGCCAGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCTAATCATCCTGCTCCTGAGTATTGGTGTTCCATCGCTTACTTTGAAATGGATGTTCAAGTAGGAGAGACATTTAAGGTTCCTTCAAGCTGCCCTATTGTTACTGTTGATGGATACGTGGACCCTTCTGGAGGAGATCGCTTTTGCTTGGGTCAACTCTCCAATGTCCACAGGACAGAAGCCATTGAGAGAGCAAGGTTGCACATAGGCAAAGGTGTGCAGTTGGAATGTAAAGGGGAAGGTGATGTTTGGGTTAGGTGCCTTAGCGACCATGCAGTCTTTGTACAGAGTTACTACTTAGACAGAGAAGCTGGGCGTGCACCTGGAGATGCTGTTCATAAGATCTACCCAAGTGCATATATAAAGGTCTTTGATTTGCGACAGTGTCATCGGCAGATGCAGCAGCAGGCGGCCACTGCACAAGCTGCAGCAGCTGCCCAGGCAGCAGCCGTGGCTGGAAACATCCCTGGCCCAGGATCAGTAGGTGGAATAGCTCCAGCTATCAGTTTGTCAGCTGCTGCTGGAATCGGTGTTGATGACCTTCGTCGCTTATGCATACTCAGGATGAGTTTTGTGAAGGGCTGGGGACCGGATTACCCAAGACAGAGCATCAAAGAAACGCCTTGCTGGATTGAGATTCACTTACACCGGGCTCTCCAGCTCCTAGATGAAGTTCTTCACACCATGCCTATTGCGGACCCACAACCTTTAGACTGAGGTCTTTTACTGTTGGGGCCCATAACATTCTTTGTCAGGATGGTGGACTATAAAATACAATCCTGTTTATAATCTGAAGATATATTTCACTTTCGTTCTGCTTTATCTTTTCATAAAGGGTTGAAAAATATGTTTGCTGCCTTGCTCCTAGCAGACAGAAACTGGATTGAATCAATTTTTTTTCCTATTTAGAACTTTTCAGGCATGGCTCAGAGCTTGAAGATCAGGAAAAACACATTCTTATTAAATCTTCACCAGTTATATATGAAGGAATCATTCCAATGCTGGAAAATTTAGCCCTTTAAACTGTCTTAGACCCTTTTATATGCAGAACATCGATATGTGTGTTATTCTACAGAATAAATTCAATATTGCTGATTTTAAAGGCAGAGAAGCTCTCTAAGTTAATTCACCTATGTTATTTTGTGTGCGAGTTGTTATTGTTGAACATACTTTACTCCCAGGTATTGTGCCATGTGGGTGAGTTAATTTTACCAAGAGCAACTTTACTCTGTGTTTAAAAAATAAGATAGTAATGTATTATAACCTTTTATCCAAAATATTTTTTGCAAGTTAAACTAGTGAAGATGATTTCAATTCAGATTGTCTTACGATTTCAATTTTATTTTCGCCAAGGCAAAACACTAATCTCTGTGTATACTGAGAATTCTTTAAAATTATCAAAGTAATATCATTTAAAATTACACTCGTTATCCCTGTTGGATAACTATTTATCAAGTAGTGTACTTTTGCCCTGTTAAACAGTAGACGTAGTATATATTTCTAGGCACAAGGTTGGTTACTAAGCAGCCTAGAAGAAGAATTTCTTTTTCTTCATTAATTCATAGGGAAAGGTTTTGTATTTTTAAAAACACTAAAAGCAGTGTCACTCCACCTGATAACTTACCATTCTGCAAAGGTGGCAATGCTTAAACTAAATGATGAGTATTTTGGAAACTGCTAAATTCTGTGTTAAATACTGTGCAGAATAATGGAAACATTATAGTTCATAATAGGTAGTTTGGATATTTTTGTACTTAATTTGATGTGTGACTTTTTTTTCATATACTGTTTAAATCATGTATGTTATGACATTGTTTAAAATTCAGTTTTTGTATCTCGGGGCAAGACTGCAAACTTTTTATACCTTTTGGTTATTCTAAGCCCTTTGCCATCAATGATCATATCAATTGGCAGTGACTTTGTATAGAGAATTTAAGTAGAAAAGTTGCAAATGTATTGACTGTACCACAGACACAATATGTATGCTTTTTACTTAGCTAGTAGCATAAATAAAACCAAATCTCAACATAAAAAGTTGAATTCTAGGTTTGATTTTTAAGTTTTTTTTCTTTTGCACTTTTGAGTCCAATCTCAGTGGCAGGACACCTTCTACTAAATGACAGGCAACAGCCAGTACTGCAGCTTTGGTTTTTCCCTTACACTCTACTGGGACTTCCCCATGGACATTATATATCAAGTAAAGAATTGGTTATTTTTTGAACTTTTATTTTACTGTAGCAAAAATAGTCCTGATTGTCTACAAGATAAATAAGTTGTCTACAAGATAAGTAGTTTGAAATAAGATCAAGGATTATCTTTCAGATGCTTTTACTGTTTGTTTGGAAGGCCTTTCTAAGTGTAGTAAGATTCTAAGGTGTGTTACAAGTTTGAGATAATGAGAAGCACTTATGCATGATAGTCATCCTTATATCGACTTAGGTGAACAAGTCTTCAACTTCCTTGCTCTGAAAGTCTTAAGACCACCTAGTAACCACTGAGTTTGCTTATTGCTGTGATTTAAACATAGTTGTTGATTCAAGCTACATGTTTTTTGTTTTTAAAATAACTTCTTTACCAACTCATTTGTACTCTTGAGTACTTACAGATACCTTTGTTAAAAACCTCATTTTAATCTGTAAAAGTATGGTGATTTAAGTTTAATTGGCAGATTTTTTAAAAAGATATTTTTATTCTTTAGAGATTATTGACTTTAGGTCTATTTTACTGTGAATGAAAAGTAGGAGTGAGAGTAGAGTGTTTTAGAATGACAGATTTTTAAAATCCAGTTTATTTGATTAGAACCATAAGCATGTTATGATGTAATCTATTGCCTCCTTTTCTACTTTAAGGAAAGTTTTCATGTCTGGGGAAAGTACATGGAAAATATTTGCTAAGAAGTCTGTCTTTGAGGCCAAGCCACCTTTCTTGGTTTCTTTCTGCTAAGAGCCATAAAAGTACTAAAAGTACATAGAAGTACTTCTAGTTATTAGTTGCTACATACTTATACCTAGATGCAGTCACATGCTTTTGAGAAAACATCTAGTATGTTATGATCAGTTATTCCTGAGAGCTCAGTTGTTAAATGGTATTTCCATTTCTTAAAGGTAGTCATCTTTGATGAGTAAGACTAAATCACTAGGTTTAAAATTTGGGGCTGCTTTAAGGATAGAATAGTTTCTACAGTTCTCGGAATCTGATTATTATGAGGATACGACTCTGGGTGGGTTTTCTCTCTCTAGTTCACCT