Transcript asmbl_56078

Sequence
Transcript Sequence for observation asmbl_56078 of TGE0006300:
GGCCCCGGCCCCGGAGGATGCTGAGCCCCTGCCCGGACCGTCCCGGAGCACATGATGGCGATACGGGAGCTCAAAGTGTGCCTTCTCGGGGACACCGGAGTTGGGAAATCGAGCATTGTGTGCCGGTTTGTCCAGGATCACTTTGACCACAACATCAGCCCGACCATTGGGGCGTCTTTTATGACCAAAACTGTGCCTTGTGGAAATGAACTTCATAAATTCCTCATCTGGGACACTGCTGGTCAGGAACGGTTTCACTCCCTGGCTCCCATGTACTATCGTGGATCTGCTGCAGCTGTCATAGTGTACGACATTACCAAACAGGACTCATTCCACACCTTGAAGAAATGGGTGAAAGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCTATTGCTGGGAACAAATGTGATCTCTCAGATATAAGGGAGGTTCCCTTGAAGGATGCAAAGGAATATGCTGAATCCATAGGTGCCATTGTGGTTGAAACAAGTGCAAAAAATGCTATTAATATCGAAGAGCTCTTTCAAGGAATCAGTCGCCAGATCCCACCCTTGGACCCCCATGAAAATGGAAACAATGGAGCAATGAAGCTTGGGAAGCAAGCTACGCAAGCCAGCCGGCGGTGCTGCTGACCAGGGGTCACGGCCCACTGTACTTGAAGAAGCCAGAGTCACCTCCCCATGCACTGCTGAAGGACCCCCTAATCTTAGTGGCCTGGCGCCTCACTTAGAGAGAAGTGAGCACACTGGCTTGGCATCATGGAAGACCCACAGGGAACGGGGCAGGAAAAGTCCCCGGAAAAGGATTTGAGAAAACTCTGGAAAAATTCACCACGTCGCCTTTTGTGCATGAAATGCACACGGGAGGGAATGGATGTTAGGTAATAAGTATAGTTGAGTTTTTGTTAAACCTTAGAATATTCTCGATTTGTACAAAAATTTTACTGGTTTATTATGTGTGTGAGATTATAAAGTGGTGTTCCACTCTGATTTCCTGTGTTCCCTAGCCAAACTCCAGTAACTTCTTCAGCGCCATTGCTTCTGTTGACTAACCAGCCTTCACTGAAAGGTTAATTTAATTTTATTTAGTTTGCCTTTCACTGGAGCATAATTGGATCATCACTCAAGCTGTGGACTTGAGCTTTTATAAAAGTGGAGAAAGATGTATTAGAAACTGTTGTCAATATCTCCGACTCTTACTTGATGAACATTTTTCCAAGTTTTGATCATTATAAACAAACAAGCCCAATCTGGCTAAAAATATTGCATTTAATTTTGGGAGTGGGAGGCCTAATTTGGAAGAGTCGTTTAAAGTCACTGTATAAGCGGTGACAGATGTAGGACGTAAATATTATTCCAGAGACCATTTGGTATGCATCACCTCCACAGCAATAAATCCCTACTCTCTTAGAGAGGTTTTAATGCACAGAGTATTATTTTACTAAGAATTTGTGATAGTGTCACGTCTAAGGGGGAAATTAACTGGAGGACATTTAAGTCTATATCATAGGGCAAACTTCTAATAGCAGTTAATAACAGGTTACTGCAAAGCCAGCCAAGGGAAGTCCCAGCACCTTAAGATTCTAGACCTCTAACAGCACAATCAGAGAAAGCATTTGAGGAGATGCCAAGCCTGGGGAGGCAGATCTTAGGGCTAATGAGGACTCCAACTTTGGGATGCCAATTAACTGGGACTAGGCTGTGATAAAACCTTCCTTTTCAGGTACCCTGTCTGCTCAATTAATTAAAGATGTCTGACTGCAAAGGCAGTAAAGGGAGAAAAGGCATGAAGAGGAAGAAAAACTATTTCTATTCTAAATTCAAATCCTATTACCATTTTAATTTTCATAAAAACCTGGAAATCAAGAAGCAGTATGAGTGTGTGTGTGTGTGGGGTCCTATTAGGTCTTATATCGGGAGGTGATTCTTAAGATTTGGAATCGTGCCTTTTGTTGGGGTTAAGGAACTGTGACAGAATGGCCTCAGAAATGGTTAATTGTGCAGCATGGTCCAGCCGGTACCTTCTTTGCCATAAATGTTCAGGGGCTGAGAAACATTTATTGAAAATTTACAGTGTTAAAACCAGCAGAGAGATCATCAGCTGATTAAAGACCTCAAACTTTGAGTAACTCATGTGAGCTGGTGCTTCATGTCTTGCCACGACTGTGCCCTCTTTGCTCTTCACATATAGTGACACCGAGTCCCAACAAAAAGAAAGAGTCCTTGAGAGACCAGGGCCAAGTTTACACTTCTCTACATGGACAGTAATCAAGAAAATAGATGGAAATCACAGATTAAGGTGTTTTTGTTTGTTGTTGTTGTTTTAACAAAAGAATACGGTGTCAATTTGATTTTCTTACTTACTGCTTTGCTCAGCTTGCAAGAGTAGTTTGACAACCTTAAAATTTGAAGGCTGGAAACACTTATATTTGGTTCAAGAGTGCCTCTGAGCTCTCCCAGACAAGTACCTCAAAAAATGTTAGCAAGTGGCATTTGGATGTCTTGGTAGAGCTTTTACAGGGGTTTTTAGGGTTATCTCCACATTGTTAACATTACTTGCTAACATGATTCTGCTTGCAGGCCAAGCAATTATCATGCCTCTACAAAGCTCAAAAATTTGGGATGAAAATTGAAATGACATTTTCCAGGTGACATGCAGGCTTATTTTGGAAGCTTTCCTCATCAAGCTGTCCCTGAGAACCTGGGTTTCTCTCTAGACAGCCTCTCAGGTTTCCTAGATAAGGTGGTATGCGTCCCAGTGGAGTTACACAGCTTTAGGCTGGATCTCTAGTGGTTCTGTCTTGTATAAAATGGCTGGTCTTATAAACATGTAGAGAACTACCCACGAATGAGCCCATGGTTTTATTTCAGAAGCACATGAGGGTGTGAAACCACTCTTTTACCTTTCTGTATTGCTTTAACTATTCAAGCCAGTCAGATGACAGTGTATATAATTATTACTACTTGGAGCAACTGGTGAAAAGAGTAGATGGAACTTGGGCACACAAGCCTTCACTTAAACATGGGGTCTTCTCTGAAGACAGATGCTTCAGCCTTGTCCAGGCTTTCTTATCTTTCTTTATTCTGCCTTGAGATTACTTTCTGTTTGTTCTAACAATTGAAGTATAACCAAGTAATACTATGTAATGGCCTGGATATTACTTTTGCTCCAAAATGTCAAGTTGTTTCATGTGATGTAGCATCCTTCACATAATTTCACCAAATTTGCTCCTTTCCCTCTGTTTTCCCCCCCTTTCATGTGCAGTATATGTATATGTGTAAATATGATTTCATATTTGTTATGCCAACATATAATCCGTTTCACTGGCTAAGTTTGGCTCATGACCGTGTGTTATATAATATAGACATGGGTTCTTATTGGGATTATTTCCCAGTGGAAAGCCCTAAGATGGCAGTGGAGTCAGACATTTTATGTAGGTACATAATTGACTTGCCATTTTATAATTGAAAATGGTACACTAGTGTGTTGAATGTGATATTACCTTGTAGCCTATAGAAGATCGAAGACTTAAAACTAACCTTTAGCCAACAAAGAGCTGTGCCCCAATGAAATTTGAATTAATTTTCTGAAGGAGGTTTGGACGACTGAAATATTTCCTCTTAAGATAAAAGAATATGGCATGTGATGGCTACATTGAGCTCCTTTTAGGGGACTCCACTTCTCATTGCTCTGCAATGCTTGTAGTGAGTTGAATAATGAGCTGGCTTATGAAAGAAAGGACTCTGAGCTGTATTCAGACCTGTTAGGTATCGAGTTTACTCTTTTAATCATTATTGTTGGAACCAGACCCAGTGATCCAATGTCAGGGCTCTGTTGTGTAAACCGCTCCTTTCTCTCGTGTTTTTATAAAGGGCTTCTGTCTGGGCTGGACCCAGTTCTCACATATAGAAGATGCCACTGTAGACAGGACCTTTCTACATTGTATTCTGTAGTAAAGCATCGCCACAACATCGCCCAATTGTATCTGTTATTTTTGGTTTAACACACACTGATTCCTACTAATAAATATTTCAAGTTT