Transcript asmbl_56048

Sequence
Transcript Sequence for observation asmbl_56048 of TGE0006294:
CGCATGCCGCTACGGAGCAGCCAGGCTAAGGAAACTAACTAAAACCACGGCGTATTCGTCGGCCCCAGCCTGGCTCCCGGAAGCACACGGCGGGCTTTGCTCTAGCCTCAGCGAGAACGCCGGCCGCATCCCCCTGTCCGGAGTTGGATCCCGCCGCGCTTCCGGTGTGTTTTCCGGTCCGCCTCCCCAGGCAGGAAGTGCCGGGCGCGGCCTCTGTCGCGCCTCAGTCCATCGCTCATCGCAGTCGCTCGTCGTCTCGTGCAGGGCACCGCGGGTTCTGGTGTTGGCGACGAATTAAACAGCCACCATGTCAAGCAAAAAGGCAAAGACCAAGACCACCAAGAAGCGCCCCCAGCGTGCAACATCCAATGTGTTCGCCATGTTTGACCAGTCACAAATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAATAGAGATGGCTTCATTGACAAGGAGGATTTGCATGATATGCTTGCTTCTCTAGGGAAGAATCCAACGGACGCATACCTCGACGCCATGATGAATGAGGCTCCAGGGCCTATAAATTTCACCATGTTCCTCACGATGTTTGGTGAAAAGTTAAATGGCACAGATCCAGAAGATGTCATCAGAAATGCTTTTGCTTGCTTTGATGAAGAAGCAACTGGCACCATTCAGGAAGATTACCTGAGAGAGCTGCTGACGACAATGGGAGATCGGTTTACGGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGACAAAAAGGGAAATTTCAATTACATTGAGTTCACGCGCATCCTTAAACATGGAGCAAAAGATAAAGATGATTGAAAGAACTTTAGCTAAAACCTTTCGATTTCTTTGTCTTACTCTGTTTTATTTCCCCAGCACTTTCCCCAACATTTATCGACCTGTTGCATGCAACTTAGTTTCACAGCTTTGCCTCTTTTTTTTGATGTATTTATTCTAGACCTTTCTGCCAATTAGCACTTGTATAATCAGACTACAGATGGGGATGAGGTTGTAAATTGAAAAAGATTGCGAATAAAAATCAACAAATGTGAAAGCCCAGGAAAATATATTTGGTATTTCTGGTTTTGCTGGATTTTTACATTTTTATATAATAAAAATGCTATTTTGAAATC