Transcript asmbl_55729

Sequence
Transcript Sequence for observation asmbl_55729 of TGE0006272:
TCAGCGGGAAGCGAAGACGCAAGCAGCTAGACCGTGGGGAACCGAGGTAGGAGTTAACTGTTGTAGCGGCGGAGGAAGTCGGGAGGACGCCGACGGCCTTGCGGGCCAGTGTTTGGTCCCTTTAACCTGTGAAGATGGTGTTGCTCACGATGATCGCCCGAGTGGCGGACGGGCTCCCGCTGGCCGCCTCGATGCAGGAGGACGAACAGTCTGGCCGGGACCTCCAACAGTACCAGAGTCAGGCTAAGCAGCTCTTCCGGAAGTTGAATGAACAGTCCCCTACCAGGTGTACCCTGGAAGCTGGCCCCATGGCTTTTCACTACATTATTGAACAAGGGGTGTGTTACTTGGTTTTGTGTGAAGCCGCCTTCCCTAAGAAGTTGGCTTTCGCCTACCTAGAAGATTTACACTCAGAGTTTGATGAACAGCATGGGAAGAAGGTGCCCACTGTGTCTAGACCCTATTCCTTTATTGAGTTTGATACCTACATTCAGAAAACCAAGAAGCTCTACATTGACAGTCGTGCCCGGAGGAACCTAGGCTCCATCAACACTGAGCTGCAGGACGTGCAGAGGATCATGGTGGCCAACATCGAAGAAGTGCTCCAGCGAGGGGAAGCGCTCTCAGCATTGGATTCAAAGGCTAACAATTTGTCCAGTCTGTCCAAGAAATACCGCCAGGATGCGAAGTACTTGAACATGCGTTCCACTTACGCCAAACTCGCAGCCGTGGCCGTGTTTTTCATCATGTTGATAGTGTATGTGCGATTCTGGTGGCTGTGAAGTCGCGAATCCAGTCACTGGCAAGGGAGAACGTAGAACCTGACAGGTGTATGTTTTCGGGAAACCGAGCTCACAGAGATATGTATTAGAATCCAACTGGAACTTCCGCCTCTAAAGACCTTGCGAGAAAAGACACATCCTGAAAATGAAAGGTCACACCTCCTTTCATGCAGCTTAACCCCATGTAGAAAGTCTCTTTTGGGGGCAGACGCTTTCTCTGGGTGCTAAGCCGTATGTACGTTAGGGAACAGTAGGTCGTTGCATTTTGTTTTTTCCTCTCCTAGTGTTTTACATTTTTTTAAAGCTGCACTTACTGGGGCATCTTCATCCTCTAACAGAGCCATCAGTGAGATTGGGGTTAACCAACCTGTGCTAGCAGCAGTCTGAAATTCCTTCAGAGAAGGAAGCCCTTTGGGAAGTTTTTGACGATCTAATCAACATTCCTTTTGTCAGCGACATTTGTGATTTTCCGTAATCTGAGTTTTCGATGGCCTTTTCAACAAGACTCCAGCATGTGAAGGTTCATTGCTGTGTGTGCTGCAAAGATCTTGTCTCTTGGCCCCGATAGGAAGTTAACCTTTGTTCCCCTTTTGTATTTTGCTTATTGCACAATTGCTTTAGGGTTAAATTAATTATATTAAGATGCCTTGAAATTATATTATAGCACTCCTTGATTAAGAAGCTAAAATGTTTTCTGTCATTTATTCCTTAAAAGACTTAAGTTAGTTTGGGACAGTCTTTATTTTCAGCATCTGATGTGTGTTAATTAAAGAGGGAGGATAGTACACAGATAGCCAGAGGCCCCTGACTCAATGAGAACAGACCGTGACTGCGGCTTTGTCCCTCCCCTTCCTCACTGTCCCCGCTCGTTTCCCCCACTCTCTTTCCTCCTGCCTCAATTTGCTAACAATTTAAAAACTCTTGTGCCCAATAGTTTCATGTCCCTTAAGTGTCCTCTCAGGACAGTCTCAGATTTCAAAATGGAGAACGTTCAGCTGTGTAGTTCATTACATTTAAGTTTTTGCAGAGTGACAAAAACTACTAAATACGTTTACCCGGAACGTCTCTCAGAGCACCCCACACCTGCTTCAGTTTGTAGAAGTTCTCTGAGAATGTTCTAGACATAGAGAACTCATTTACAGTGGCTTCTGTTCACAAATAAAAGGACCTGCGATTGTCCCCTTTTTGCTCAGGGATAATGGGGATTTCCTTGTACCTTCTGAGACAGAATTTTTAAAATGCGAGGATAGGCCTTTTAGATATGTCACAAGGGTCTGCGCTATGACCTATAACTCCTACATATACTGAAAATATTTCTTTAAATTGTACAGGAAAATGAGCCAACTTCTTACTTCTTAACATCCTGAAAAAACTCCAACCAGTGAGCAATTTTATAATGCTGTGGGGTCATCAAATCTACTGTCCTGATTCCTGATAGAGGAAAAAAAAAATTCTATTTCCTTCTAACAAGGCAAGGAGAAACACTTTTATTCCTGATAATTTACAGAACTAGAATAAAATTTTTGTCTTTCCATTTTGGACCTAAATGTGCCAGTTGGCATTTTGTGCATGGAATATGAAATTACTTTTTATAGAGAATAAGTGCTTTTCGGTCCCAAAGGCTTGTCCCTGAGTAATGATGGTGGTAACGCGAGCCTTCGAAAGGGGGAAAACCTGAGCAGTGGCGCCCTAGCGTCCGGTGCTCCTGGCACAGGGAGCGTGGCAGCTCGTTGTCGAGAGTTGCATGCTGTAACCAAGTGGCCAGCAATGAAATAAATACTTCTAGAATGTTTCCTTCAGTGTGAAGTTTTGTTACCTAGTTTATTTATGCACACATGTCCTTCCAGGTGTATTTCTACCTAACCTCAGTGGGTTAATTAAAAAAGGAGAAGGCGGGGTATGGAATGACAAAGGAATAGGAAAACGGT