Transcript asmbl_55702

Sequence
Transcript Sequence for observation asmbl_55702 of TGE0006271:
CGAGAGAAGCGAGATTTATTCCTACGTACCGGGCCGTGCTGCTTATGGCGGCGCTGGAAAGGGGGCGCTGAGCTGTTGGGTATGAAGTGTAACAGAACAGACTTTACCACCTGAAACTGCTGCTTCAAGTTCAGATCAGGCAAGGAACAAACCTCGAAACAACCAACAAGACCAAAGAAGAGTACACTTTAAATTGAAGACACAACACTTGATCTGAAACAAGAAGTTTGTGCCTACTCAACAGCTTTGAAAGAGCACTTCCCAACGCTGCTAGTAGTCTTTGTTTTCTTCAGTGCTGTACTGTGAGATTGCCCGGTGCAGCAGCAGTTGTATTCTTTATTAGCCTGATAGATCATTTTCTCTCGCTCTTTTTTTTAATACTAGCAACTTTCATCCTTTGAAACGTGTGCTGAAAAAGAAGAATCAGCAAATACTACTGAAAGTGCAATATTTGATTATCACTGCGAGATGAGCTTTGATCCAAACCTTCTCCACAACAATGGACACAACGGGTACCCTAATGGTACTTCAGCAGCACTGCGTGAAACTGGGGTTATTGAAAAACTGCTAACCTCTTACGGATTTATTCAGTGTTCAGAACGTCAAGCTAGACTTTTCTTCCACTGTTCACAGTATAATGGCAACCTGCAGGACTTAAAAGTAGGAGATGATGTTGAATTTGAAGTATCATCTGACCGGCGGACTGGGAAACCCATTGCTATTAAACTGGTGAAGATAAAACCAGAAATCCTCCCTGAAGAACGAATGAATGGACAAGAAGTGTTTTATCTGACTTACACCCCTGAAGATGTGGAAGGGAATGTTCAGCTGGAAACCGGAGATAAAATTAACTTTGTAATTGATAACAATAAACATACTGGTGCTGTGAGTGCTCGAAACATTATGCTGTTGAAAAAGAAACAAGCCCGCTGTCAGGGAGTAGTTTGTGCCATGAAGGAGGCGTTTGGCTTTATTGAAAGAGGTGATATTGTAAAAGAGATATTCTTTCACTATAGTGAATTTAAGGATGACTTAGAAACCTTACAGCCTGGAGATGACGTGGAATTCACAATCAAGGACAGAAATGGTAAAGAAGTTGCAACAGATGTCAGACTATTGCCTCAAGGAACAGTCATCTTTGAAGATATCAGCATTGAACATTTCGAAGGAACTGTAACCAAAGTTATCCCAAAAGTACCCAGTAAAAACCAGAGTGACCCATTGCCAGGACGCATCAAAGTTGACTTTGTGATTCCTAAAGAACTTCCCTTTGGAGACAAAGATACAAAATCCAAGGTGACCCTTTTGGAAGGTGACCATGTTAGGTTTAATATTTCAACAGACCGACGCGACAAATTAGAACGAGCAACCAACATAGAAGTTCTATCAAACACGTTTCAGTTCACTAATGAAGCCAGAGAAATGGGTGTAATTGCTGCCATGAGAGATGGTTTTGGTTTCATCAAGTGTGTGGATCGTGATGCTCGTATGTTCTTCCACTATAGTGAAGTTCTGGATGGGAACCAGCTCCATATTGCAGATGAAGTAGAGTTCACTGTGGTTCCTGATATGCTCTCTGCCCAAAGAAATCATGCTATTAGGATTAAAAAGCTTCCCAAGGGCACGGTTTCATTCCATTCTCATTCAGATCATCGTTTTCTGGGCACTGTAGAAAAAGAAGCCACTTTTTCCAATCCTAAAACCACTAGCCCAAATAAAGGCAAAGAAAAGGAGGCTGAGGATGGTATTATTGTTTATGATGATTGTGGAGTGAAATTGACTATTGCTTTTCAAGCCAAGGATGTGGAAGGATCTACTTCTCCTCAAATAGGAGATAAGGTTGAATTCAGTATTAGTGACAAACAGAGGCCTGGACAGCAGATTGCAACTTGTGTGCGACTTTTAGGTCGTAATTCTAACTCCAAGAGGCTCTTGGGTTATGTGGCGACTCTGAAGGATAATTTTGGATTTATTGAAACAGCTAATCATGATAAGGAAATCTTTTTCCATTACAGTGAGTTCTCTGGTGATGTCGATAGTCTGGAACTGGGGGACATGGTCGAGTACAGCTTGTCCAAAGGCAAAGGCAACAAAGTCAGTGCAGAAAAAGTCAACAAAACGCACTCGGTGAATGGCATTACTGAAGAAGCTGATCCTACCATCTACTCTGGTAAAGTCATTCGCCCCTTGAGGAGTGTTGATCCGACACAGACTGAGTACCAAGGAATGATTGAGATCGTGGAGGAAGGGGATATGAAAGGTGAGGTCTATCCATTTGGCATAGTTGGAATGGCCAACAAAGGGGATTGCCTACAGAAAGGGGAGAGTGTCAAGTTCCAATTGTGTGTCCTGGGCCAGAATGCACAGACTATGGCCTACAATATCACACCCCTACGTAGGGCCACAGTGGAATGTGTGAAAGATCAGTTTGGCTTCATTAACTATGAAGTAGGAGATAGCAAGAAGCTCTTTTTCCATGTGAAAGAAGTTCAGGATGGCATTGAGCTACAGGCCGGAGATGAGGTGGAATTCTCAGTGATTCTTAATCAGCGCACTGGCAAGTGCAGTGCTTGTAATGTTTGGCGAGTCTGCGAAGGCCCCAAGGCTGTTGCAGCTCCACGACCTGATAGGTTGGTCAATCGCTTGAAGAACATAACCCTGGATGATGCCAGTGCTCCTCGCCTAATGGTTCTTCGTCAGCCAAGGGGACCAGATAACTCAATGGGATTTGGTGCAGAAAGAAAGATCCGTCAGGCTGGTGTCATTGACTAACCACATCCACAAAGCACATCATTAATCCATTATGATCAAGTTGGGGGGATTCTGGTGAAGGGTTCTGAATATCTCCCTCTTCATCCCTCCCAAAATCTGGAATACTTATTCTATTGAGCTATTACACCAGTTTTAACACCTTCCTCGTGTTATGTTTAAAAAAAATAAATAAATTTAAGAAAACCATTTTAAAATTATGCACAGTTGCAGCCTGGAAAACTTAAGGTGGCGCCTTATAGTATCAATTTTAGAAGCTTTATTTGGTGCATTTAACGCAACTGGTAATTGCAAAATCCACTTCCCCTGTGTAAGTGAAAAGTATAGACTGTTATCTTGTTGGCCCTATGAAATTCTGCACTTGATATTCAGTATATACTCTACCTTCATTACTTCTGGCAAGGTGTTCGGCCTTAGCACTCAGTTGCATTCTTTCCTGTTCATTATGCTTTAATTCTGAGGACCATATGAGGGTAGAATATATTAAAAATTACAAAAATTTGTATAGGCGAACCATTTCCTTAAGTTGGTGGCCAAATGTTAAAATGTTATTTTTCATATCATTTATAATCTTGTCACAGTCCACTTAACAAAGTTTGGTTAGATTTCAATGAAAATTATCTTCCAGAGTAGTTTTTTTTTCCTGGGATGGGAGGGGGGTAAACTTTACTACAAATAGTATGTATGGTGCAGAATTTCATGCAAATGAGATGTGCCAGCAGTGTGATAATTTAAACGTATTTAAACAGAAACAACAAAAAAGGACAAATGCACAAACTCGCTGCTGCTTAGATCACTGCAGCTTCTAGGACCCAGTTTCTTTTACTGATTTCAAAACAAAACAAAAAAATAAAAAAGTTGTGCCTGAAATGAATCTTGTTTTTTTTATAAGTAGCCGCCTGGTTCCTGTGTCCTGTAAAATACAGGCACTTGACCCTTGGTGTAGCTTCTGTTCGACTTTATATCACGGGATTGGATTGGTCTGATTTCTTGGCCCTCATCTTGAATTGGCCACATACAGGACAGGGTCCCTGGCCAGTGGACTGAAGGTTTTGTCCACAAGATGACAAAAGGTCAGCTCAGGGGATGTGTGGGAGGGCACTTTTATCTTCCCCATTGTCATTTGAGTTTTTGATCTCTGGGTAAAGAGGCCGTTTATCTTTGTAAACACAAAACATTTTTGCTTTCTCCGGTTTTCTGTTAATGGCGAAAGAATGGAAGCGAATAAAGTTTTACTGATTTTTG