Transcript asmbl_55666

Sequence
Transcript Sequence for observation asmbl_55666 of TGE0001954:
CTCAGTTCTGCGGCAGTGTGAGTGGATAGAGTGGCGGTGCACTCGTGTTGGCTCTCAAAATCCCCGCGTAGCCACTGTCGCCTTTTCCAGCCCTCGCCATGTTCCTCACCCGGTCTGAGTACGACAGGGGTGTGAATACTTTTTCTCCTGAAGGAAGATTATTTCAAGTGGAATATGCCATCGAGGCTATCAAGCTTGGTTCTACAGCTATTGGAATCCAGACATCAGAGGGTGTGTGCCTAGCTGTGGAGAAGAGAATTACCTCCCCACTCATGGAGCCAAGCAGCATTGAGAAAATTGTAGAGATTGATGCTCACATAGGTTGTGCCATGAGTGGGCTAATTGCTGACGCTAAGACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACATACAATGAGACAATGACAGTGGAGAGTGTGACCCAGGCTGTGTCCAATCTCGCTCTGCAGTTTGGAGAAGAAGATGCAGACCCGGGTGCCATGTCTCGTCCGTTTGGAGTAGCACTGTTATTTGGAGGAGTTGATGAGAAAGGACCCCAGCTGTTTCATATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCTTCAGAGGGTGCCCAGAGCTCTTTGCAAGAAGTTTACCACAAGTCTATGACACTGAAAGAAGCCATCAAATCTTCACTCATCATCCTCAAACAAGTAATGGAGGAGAAGCTGAATGCAACTAACATAGAGCTAGCCACTGTGCAGCCCGGCCAGAATTTCCACATGTTCACAAAGGAGGAGCTCGAAGAGGTTATCAAGGACATTTAAGGAAGCGTGATCCTCAGAGCTTCTCTGGGACAGTTTCAGTTCTCCTAATTGCCCTTAACTTTTATTTCCAGCTCATATTCCTTGGAAAATCTCCAGTATATGTGCATTTTTTTATGATGTCTGTACATAAAGGCAGTTCTGAAATAAAGAAAAATTTAAAGTATTTGTTAATAGACTATTCTAATGCAGTCTTTTATTCAAACTGCTTATGTTAGGGAGCAAGAAAGATAGTGGTATTCATATCCCTGCCCTCTCAGAGTATCTATTCTGAAATAATTTTAGTGGCTTGCTGCAACAGAATCAACTATATCATGAGTTCCTGAGTGTTGGCAATGAACTCAAACTAATCCAGCTCCTCCCAGTGGTTTAAGATGTTAATACCATTGTAAAGCCACTTCAATCCTATAGTTAATCTTGAGTAAACAGGTATTTTTGCTGCTTTTCTTATATGAAGGAGATGCTACTAATTGACCATCAAAAGAACATGTTTTGAGGTCCTCCCCAAACCCTGATGAACAGTTAGAATACACCAGCTATGATGTTGTACCAGTTCTAGTGTCTTAACAGACAATTTGAAAAGAGATTTAAAAAAAAAATTTAGGTAAGGACAATAAAAATGGAATTCAATTACAAAACGAGTATGAGAGAATGGTATAATTCTTCAGTAGTTTATATTAAACACTTTGGAATGTACTATGAACTTCCTCCATTAGAGCTGCCATCATATAACTGGTTGAGATTAAAGAATCAGTCTATTCGAGCCTCAAAAATGGCCATATAAAGTAGATCTCATTATTGTATTTAACATGAAGAATCTAAGGCTGTGTGACTGGACAGAAAATTGAGTTGTTAGGAACCAAACTCAGATTTTCTGGTTTCAAATCATCAACTCTTTGTTTTACGACGCCAGGTCCTTTGAAGCCTAGACACCTACTGAGTAATGGGGAAATCTCATCGAGATTTGAAATGTATTTGCAACATCCACAATGTGGCTAATCAACATGTGGATAATGCAGAATTGATTGTGTATTGTCTTCATTAACATTTGTAGGAAGTTGTACTCTGTGATGTCAAAATAAATGCAGATGATTTAAGTAGGCTGAATTTATATTAAACTCACCATATTTC