Transcript asmbl_54735

Sequence
Transcript Sequence for observation asmbl_54735 of TGE0006217:
GGGCAGCAGTTTCTCTATGCTCTGTTCCTCTTATCGCGAGAAAAAAAATGCGAGACGAAGTAGAGTGAAAGAGGTCACACGTTATCTTCTCGCGAGGTTTGCGAGCGACCATCTTGCTCCTGCCCCTGACAGACTCTGTTCCAGGTCAGTGGGACGCTAAGACCGCCGAGTGACCCCTCGCTGACCATGTTGTCCCGGGTGGTACTTTCTGCCGCCGCCACAGCAGCCCCCTCTCTGAAAAACGCAGCCCTCCTCGGTCCAGGAGTATTGCAGGCAACAAGGATCTTTCACACTGGGCAGCCGAGTCTTGCCCCTGTACCACCTCTTCCTGAATATGGAGGGAAAGTTCGTCATGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCCAAAACCGGTGTAACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTTCTGTCCAAAGAAATATATGTGGTTACCCCAGAGACCATCTCTGCCATATCAACAATAGGGTTGCTTGTCTATGTAATTAAAAAATATGGTGCCTCTATTGGGGAATTTGCTGATAAACTCAATGAGCAAAAAATTGCCCAACTAGAAGAAGTGAAGCAGGCTTCCATCAAATACATCCAGGATGCAATTGATACGGAGAAGTCACAGCAGGCACTGGTTCAAAAACGTCATTACCTTTTTGATGTCCAGAGGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACAAGGAGGTAAAGAGTCGCCTGGACTACCATATCTCTGTGCAGAATATGATGCGTCGAAAGGAGCAAGAACACATGATAAACTGGGTGGAGAAGCACGTGGTACAGAGCATCTCTGCACAGCAGGAAAAGGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGCTTGCAAAGAAGGCCCAAGCACAGCCAGTTCTGTAAATGCGTCTATCCTGATCCAGACAGCTAGAAACAGTTGACTGACTAAATGGAAGCTAGCCTATGGGACAGAATCTTTCTGTACTGCGTTCTACTGAAGTTTCATTTCATCTTACCTGAAAATGAAAAGCTTGGGTTCATATAGAAAGAGAATTAAAACAATATTTTGGTCAGTGAGATGCTTCTTGTCCTTCTTGCTCTGCATTTTAAGTTGGTCCATGATCACTTTTGATTCAGCAGTTTGCTTTTAATAGAATTTAGTGCCTGACTAGAGACTACCAAGTTACAGTTTAAATTTGTAATTTATTCTACCATCTTGCAATAGACTGACAGTTGAAACAAG