Transcript asmbl_54143

Sequence
Transcript Sequence for observation asmbl_54143 of TGE0006146:
CGGCGCCCGAGCAGCCAGAGGAGTAGGAGGTGGAGGAGGAGAGGTCGGAGCCGTCTCCAGGAGCCCTTAGAGACCGAGTCCCCGGCGGCGGCGGCGGGGCAGCGCACGGGCGGACTAGTGAGCACCGAGGGGCAGGCGCAGGAGATTCATTCTCCCCACTTGAAACCTGAAAAGAGTGGGCCACACAAAGTCTTACTGGTTCCAGGTGAAAACAGTAACTGAAGATGTCAAGCAAAACAGCAAGCACCAACAACATCACCCAGGCACGGAGAACTGTGCAGCAGTTAAGACTAGAAGCCTCCATTGAAAGAATAAAGGTTTCAAAGGCCTCAGCGGACCTCATGTCCTACTGTGAGGAGCATGCCAGGAATGACCCTTTGCTGATAGGGATACCTACTTCAGAAAACCCTTTCAAGGATAAAAAAACTTGCATCATCTTATAGAGGAGTGAAATGGTTCCTCACGTCTTCTCAACAAAGCAAATTATGAGCAGCTCCTTGAAGAGAATTACCTTCAGCTTATTTGGTAACCACTGCTAATAACTAAAATGCTCTTAACATGGAATAATAGACTCTGAAGTCTTTATTTTCCAACTTGTCCTTTCTCTGAAATACCCTTTACTGATTTAATACAATCCCATTTTCCATTTGGCAACTGTGGTGTCATATTGGGTTACTGATTAAGGAAAGTCAGTCCGGGCCCTTTAAAAAACTCAGTTATATACTTTTAAATATATGAATGATCCAGTTATATCAAGACCTAAATTAACTAAGCCCCTATCTAGATTAAAATGCCAAGAGTAATTTAAGTCCTTAAACCTTTATATCATAATGTGTTCTTAATAGGGTTGTGCCAACCTGTACAGTATACACGGGTGAGGAGTGTTTTGTGTATATATGTATGTCTTTGTATATACACATCTCAAAGCTTATTTCCTTATTAAAATTTCTCTCTCTCCATACCATCAGTTAAATCCACAAGTTATACCTTTATCTTAAGCTGTGTGTAGGTAGAATAAGAACTTCTTTTCATATAGTTATTGTACAAAAAGTAAAGGACATCCTAAAGGTCGTATTCATTGTAATCAAATAATGAAGTCATCTCTTGCTGACCCTCTAGTCTACAATAAACTGTGCCAATTAAAATTTTAAAACTCAGCTAAAAGCCCTTTTATAATATGATATTCATTCACCAGGGGCCTTTTCGGGCTTCAGTGATCCTGAGTCTAAAAAAAGGGGAGGACAGTGGGCAGCTGTGTCCCCAGGGCTCACATTCTCTGGATTAGGGGTTACATCTCTGAAGTTTTCACCCTAATGATGGGGATGAAACAGAGTACACAGGAGGCTGGCCGAGAGTTTTTTTTCCTGTTCTTGGCCGAACTTTATGATTTAGCTCTTTTTCTCTCTGCCTTTCCTATATCTTTCCTCTCCTGCTAGAAAATCTATTCCAGCCCCAAGTGGGTGGAACATGGTGGGAAAGAAACATACAAAATCATAAAGGTATCAAGACACAAGCTCTTTTCAAATATCTTCAGTGTCAGCCTCATCCCTACCTTGTCCCCGAACCATCCAAGAGAGGCTTGGTTTCAGTGGTACAGAATTTGGGCCCAAGGGTCCCAGGAGCTGGACATTGGGTTCCTTGATTTTCCTCTGGACACGAATGTAGCCCTCACATCCTCGGGATTTCCAGTGGGTATCCCAAAAGAAGGAATCTCCTATGACCAGAGAGTATTTTAACTTTATCAAAGAAGAAGACAGGTTATTTTTCTTAAATGCTCATTTAAGGGCCCAAAACATACACTTGGCCTATAATATTTTAATTCATCTTCAGTTCGTTAAAAATAACGACAAATGATGAAGGGTTAAAAATGTATTCTCAAAGAGGATTCAAGCCCAAGAAGGAATTATTTACAGTGGTTTTCCCTAGTTCTGTACAATCTCGCCCTGCAGTGCAAGCCCCTTTTAAAATCTAATGTCTGAGCTTTGGATAGTATGCTAATTTGAGTGAACAAATGCAGTACTATTTTTAAACTGCTCAAATATATTCAGTATTTCTCCAACTCACCTATCTATTCGGCATTGTGAACTGCCCTCATATTTCTAAGACTGGGTGAAAATCATGGCACTGCCCTTAACTTCTTGTCATCTACTGCTTGGTTCAGCAATATGCCCAATTCCCAAGTAAATTATAGTTACCTGTTTAGGAGAGAGAAAGATTTTACCTTTCAGAAGGTGAAATTTGAAATGTATGCTAAAAAGATGACTTTACCTTTAATGATTAACTTAAGGAGATATTCTTTTTTAAAATAAATATATTTTTCTGATAGTTTCAGAACACTAATCTTATTTTCACTCCGATGTTTAACATGTTTCTTTAAATATTTATAATGCATCTTGTTACAAAGTATTTTCATGAAATTATGTTTATTATATTGTTATGTGCACAGTTTTTGGTAGCAAGCATAGTACTAAAACATGTTCTTTTACCTAACAGAAAACAAATATGTTTTGCTATATATTTGTTAATATGCTTAAAGTGGTAAGGAATGGACTTGAGGTCCCAGGAGATTTCATTTTATTTTTGCTGGCCAGGTATCCATTAAGGCCATGAATATAAATGTCGTGTAACTTCCTAACCAGGTGTGGGGCATGTTTAAGAAAAGTGAAATCAAATCCTTTGATGCTGGACCCAAGAGGGGAAAAATTGTAGTTAAATGTTGATTTACTTATAACTAGACATCTGTGTGAGAAAATATATGTATACACATATATGATATGCAGAAGTCACTATTTATCAGGCTTTATTCTACTTACAAAGCCACAGTTTGACTGTTCTGCAGCAGCTGGTTTATGACAATGGTGGACAAATGCCCAGTGCGTGTTAATTTTTCCAGCTACCATCATAATGACATAATCACGTATATATATGCAGCCATTTAAATATTTTCACTGTACTTTATCTTTAATGCTGCTTCTGTTAACAGTGATTTTTTTTTTCATTTTTATATTTTTATTAGTTCATCATAATCCTGTCCATTGAGGCCTCAGGACCATGGCAAGATATGCTATACAAAATTTCATGACTCCAAAGAATTTTACAGAACATTTTTTTTTCTATAAACACTTCATATACCAGGTGGTTCACAGGTTATAGGTAGTAACTACTTTTTTTCTAAAAAGAATCAGGTTTTTACATTTCCTTGCCCTACTGAAATAAAAAGTGCCATACTTATCTTTTAAAGGAAGGACTTGATTTGCTTTCTCTCTGGACTATTTTTGTACTTTACTAATCTAAACTATCAGAAAATACAAGTCTACCAATGATTTCGTAATTTTGAGACATAGGTTAGTTTAGGTAGAGGAGGATGTGCCAAACTTTTTCTTCAGATGCTTTCTTCTCAACCAATTTACAACTAAGATAGTGTCCTCTAAGTGATTACTCTGAATTTTGATTTAAAGTCTATATAGGCCCAAGAAGTGAATTATACTACATATCATTCTTTTCTCAATAAAATATAATACAGTATGTGTTAGGAATTGTGTTGATTTCCTTTATGGTATATCTGTTAATAGGAAAAAGTACATTGAATCAAATAGAAGTATATGTGTATTAAAACAGAGCACTTACCTAAAATTGGGCGGCCTGGATCTTAGCCCTAGATCATTTTCTAGCCAATCCTGTGTCCCTGTGTTGTGACTTTGGACAAGGCACTTGCTCTCTCTGGGCCTTCATTGCACCATCTGTAAAACAAGGGGCTTGAAGTAGATGGTGGCTGAGATCCCTTCCTGCTTTCAGATGTCTCGTTCCAATGGCCTACACCCCTACTGGTCCTGCCAACGTGTTGGTGCTATAAGCTGCTTCAAATATAAAATTGGTTTGTCTGTCATGTATGCTCATTTAATAGCTTATGAAAGGCCTTTTTGTCATACAGCTTTTTATTTCTAGTTTTACGGACTTGATTACTGTAATAATGTCTTGTTTTTAGTCATGTAACTATAAACATATACTCTCTTGATGTCTCAGTAAATTTGCATTTGATAAATATAGTTGATGGGATTTTGTTATTTTATAACATTCTTTGGCTACTCATCTGTCCAGCATCTTATTTACCTAAACACTGTGATCATTGTTTGGAAATCTGTCCTATGGAAAGAATAAAAGCATTTACTTCACAGCTAATATGTTCACAGATTTGAAAGAAGTTTCATTAAAGCACCATTACTCTC