Transcript asmbl_54142

Sequence
Transcript Sequence for observation asmbl_54142 of TGE0006146:
AGGATGGCGGCCCTCACCTAGGAGAACCAGGAAGGCAGGCAGCGCTAGAGAGACGGGGTTGGGTTCGACTATTGCCAAAACAATCACATTCAAATTCATTCTCCCCACTTGAAACCTGAAAAGAGTGGGCCACACAAAGTCTTACTGGTTCCAGGTGAAAACAGTAACTGAAGATGTCAAGCAAAACAGCAAGCACCAACAACATCACCCAGGCACGGAGAACTGTGCAGCAGTTAAGACTAGAAGCCTCCATTGAAAGAATAAAGGTTTCAAAGGCCTCAGCGGACCTCATGTCCTACTGTGAGGAGCATGCCAGGAATGACCCTTTGCTGATAGGGATACCTACTTCAGAAAACCCTTTCAAGGATAAAAAAACTTGCATCATCTTATAGAGGAGTGAAATGGTTCCTCACGTCTTCTCAACAAAGCAAATTATGAGCAGCTCCTTGAAGAGAATTACCTTCAGCTTATTTGGTAACCACTGCTAATAACTAAAATGCTCTTAACATGGAATAATAGACTCTGAAGTCTTTATTTTCCAACTTGTCCTTTCTCTGAAATACCCTTTACTGATTTAATACAATCCCATTTTCCATTTGGCAACTGTGGTGTCATATTGGGTTACTGATTAAGGAAAGTCAGTCCGGGCCCTTTAAAAAACTCAGTTATATACTTTTAAATATATGAATGATCCAGTTATATCAAGACCTAAATTAACTAAGCCCCTATCTAGATTAAAATGCCAAGAGTAATTTAAGTCCTTAAACCTTTATATCATAATGTGTTCTTAATAGGGTTGTGCCAACCTGTACAGTATACACGGGTGAGGAGTGTTTTGTGTATATATGTATGTCTTTGTATATACACATCTCAAAGCTTATTTCCTTATTAAAATTTCTCTCTCTCCATACCATCAGTTAAATCCACAAGTTATACCTTTATCTTAAGCTGTGTGTAGGTAGAATAAGAACTTCTTTTCATATAGTTATTGTACAAAAAGTAAAGGACATCCTAAAGGTCGTATTCATTGTAATCAAATAATGAAGTCATCTCTTGCTGACCCTCTAGTCTACAATAAACTGTGCCAATTAAAATTTTAAAACTCAGCTAAAAGCCCTTTTATAATATGATATTCATTCACCAGGGGCCTTTTCGGGCTTCAGTGATCCTGAGTCTAAAAAAAGGGGAGGACAGTGGGCAGCTGTGTCCCCAGGGCTCACATTCTCTGGATTAGGGGTTACATCTCTGAAGTTTTCACCCTAATGATGGGGATGAAACAGAGTACACAGGAGGCTGGCCGAGAGTTTTTTTTCCTGTTCTTGGCCGAACTTTATGATTTAGCTCTTTTTCTCTCTGCCTTTCCTATATCTTTCCTCTCCTGCTAGAAAATCTATTCCAGCCCCAAGTGGGTGGAACATGGTGGGAAAGAAACATACAAAATCATAAAGGTATCAAGACACAAGCTCTTTTCAAATATCTTCAGTGTCAGCCTCATCCCTACCTTGTCCCCGAACCATCCAAGAGAGGCTTGGTTTCAGTGGTACAGAATTTGGGCCCAAGGGTCCCAGGAGCTGGACATTGGGTTCCTTGATTTTCCTCTGGACACGAATGTAGCCCTCACATCCTCGGGATTTCCAGTGGGTATCCCAAAAGAAGGAATCTCCTATGACCAGAGAGTATTTTAACTTTATCAAAGAAGAAGACAGGTTATTTTTCTTAAATGCTCATTTAAGGGCCCAAAACATACACTTGGCCTATAATATTTTAATTCATCTTCAGTTCGTTAAAAATAACGACAAATGATGAAGGGTTAAAAATGTATTCTCAAAGAGGATTCAAGCCCAAGAAGGAATTATTTACAGTGGTTTTCCCTAGTTCTGTACAATCTCGCCCTGCAGTGCAAGCCCCTTTTAAAATCTAATGTCTGAGCTTTGGATAGTATGCTAATTTGAGTGAACAAATGCAGTACTATTTTTAAACTGCTCAAATATATTCAGTATTTCTCCAACTCACCTATCTATTCGGCATTGTGAACTGCCCTCATATTTCTAAGACTGGGTGAAAATCATGGCACTGCCCTTAACTTCTTGTCATCTACTGCTTGGTTCAGCAATATGCCCAATTCCCAAGTAAATTATAGTTACCTGTTTAGGAGAGAGAAAGATTTTACCTTTCAGAAGGTGAAATTTGAAATGTATGCTAAAAAGATGACTTTACCTTTAATGATTAACTTAAGGAGATATTCTTTTTTAAAATAAATATATTTTTCTGATAGTTTCAGAACACTAATCTTATTTTCACTCCGATGTTTAACATGTTTCTTTAAATATTTATAATGCATCTTGTTACAAAGTATTTTCATGAAATTATGTTTATTATATTGTTATGTGCACAGTTTTTGGTAGCAAGCATAGTACTAAAACATGTTCTTTTACCTAACAGAAAACAAATATGTTTTGCTATATATTTGTTAATATGCTTAAAGTGGTAAGGAATGGACTTGAGGTCCCAGGAGATTTCATTTTATTTTTGCTGGCCAGGTATCCATTAAGGCCATGAATATAAATGTCGTGTAACTTCCTAACCAGGTGTGGGGCATGTTTAAGAAAAGTGAAATCAAATCCTTTGATGCTGGACCCAAGAGGGGAAAAATTGTAGTTAAATGTTGATTTACTTATAACTAGACATCTGTGTGAGAAAATATATGTATACACATATATGATATGCAGAAGTCACTATTTATCAGGCTTTATTCTACTTACAAAGCCACAGTTTGACTGTTCTGCAGCAGCTGGTTTATGACAATGGTGGACAAATGCCCAGTGCGTGTTAATTTTTCCAGCTACCATCATAATGACATAATCACGTATATATATGCAGCCATTTAAATATTTTCACTGTACTTTATCTTTAATGCTGCTTCTGTTAACAGTGATTTTTTTTTTCATTTTTATATTTTTATTAGTTCATCATAATCCTGTCCATTGAGGCCTCAGGACCATGGCAAGATATGCTATACAAAATTTCATGACTCCAAAGAATTTTACAGAACATTTTTTTTTCTATAAACACTTCATATACCAGGTGGTTCACAGGTTATAGGTAGTAACTACTTTTTTTCTAAAAAGAATCAGGTTTTTACATTTCCTTGCCCTACTGAAATAAAAAGTGCCATACTTATCTTTTAAAGGAAGGACTTGATTTGCTTTCTCTCTGGACTATTTTTGTACTTTACTAATCTAAACTATCAGAAAATACAAGTCTACCAATGATTTCGTAATTTTGAGACATAGGTTAGTTTAGGTAGAGGAGGATGTGCCAAACTTTTTCTTCAGATGCTTTCTTCTCAACCAATTTACAACTAAGATAGTGTCCTCTAAGTGATTACTCTGAATTTTGATTTAAAGTCTATATAGGCCCAAGAAGTGAATTATACTACATATCATTCTTTTCTCAATAAAATATAATACAGTATGTGTTAGGAATTGTGTTGATTTCCTTTATGGTATATCTGTTAATAGGAAAAAGTACATTGAATCAAATAGAAGTATATGTGTATTAAAACAGAGCACTTACCTAAAATTGGGCGGCCTGGATCTTAGCCCTAGATCATTTTCTAGCCAATCCTGTGTCCCTGTGTTGTGACTTTGGACAAGGCACTTGCTCTCTCTGGGCCTTCATTGCACCATCTGTAAAACAAGGGGCTTGAAGTAGATGGTGGCTGAGATCCCTTCCTGCTTTCAGATGTCTCGTTCCAATGGCCTACACCCCTACTGGTCCTGCCAACGTGTTGGTGCTATAAGCTGCTTCAAATATAAAATTGGTTTGTCTGTCATGTATGCTCATTTAATAGCTTATGAAAGGCCTTTTTGTCATACAGCTTTTTATTTCTAGTTTTACGGACTTGATTACTGTAATAATGTCTTGTTTTTAGTCATGTAACTATAAACATATACTCTCTTGATGTCTCAGTAAATTTGCATTTGATAAATATAGTTGATGGGATTTTGTTATTTTATAACATTCTTTGGCTACTCATCTGTCCAGCATCTTATTTACCTAAACACTGTGATCATTGTTTGGAAATCTGTCCTATGGAAAGAATAAAAGCATTTACTTCACAGCTAATATGTTCACAGATTTGAAAGAAGTTTCATTAAAGCACCATTACTCTC