Transcript asmbl_53219

Sequence
Transcript Sequence for observation asmbl_53219 of TGE0006121:
CTAAAGTGTGTTCGCTTGACGGCGAGCAGAGCCCAGCATCCGCGAGGGGCCGACGGCCAGGCTCGTCTCTCTCACGTAACTCACTCTCCTTCCACGCCGTGAGCCTAGAAAGATTGTGCGATGAATGGTGATACTCGAGCCGTCGTGGTGACCTCACCACCCCCGACCACAGCCCCTCACAAGGAGAGGTACTTCGACAGAGTGGATGAGAACAATCCAGAATACCTGCGAGAGAGGAACATGGCCCCAGACCTTCGCCAGGACTTCAACATGATGGAACAGAAAAAGAGGGTGTCCATGATTCTGCAGAGCCCCGCCTTCTGTGAAGAATTGGAATCAATGATACAGGAACAATTTAAGAAGGGGAAGAATCCCACAGGCCTGTTGGCATTACAGCAGATTGCAGATTTCATGACCGCCAATGTACCCAGCGTCTACCCGGCAGCCCCACAGGGAGGGATGGCAGCCTTGAACATGAGTCTTGGTATGGTAACTCCTGTGAATGACCTTAGAGGATCTGATTCGATTGCCTATGACAAAGGGGAGAAATTACTGAGGTGTAAATTGGCAGCGTTTTACAGACTAGCAGATCTCTTTGGATGGTCTCAGCTTATCTACAATCATATCACAACCAGAGTGAGCTCCGAGCAAGAACACTTCCTCGTTGTACCTTTTGGACTTCTCTACAGTGAAGTGACTGCATCCAGTTTGGTGAAAGTCAGTCTGCAAGGAGATATCATAGACCGTGGAAGCACTAACCTGGGAATAAATCAGGCCGGCTTCATGTTACATTCTGCCATTTATGCTGCACGACCCGACGTGAAGTGCCTTGTGCACATTCACACAGCAGCGGGGGCTGCGGTCTCGGCGATGAAATGCGGCCTCTTGCCCATCTCTCCGGAGGCGCTTTCCCTTGGAGAAGTGGCTTACCATGATTATCATGGCATTCTGATTGACGAGAAGGAAAAAGTTTTAATTCAGAAAAATTTGGGGCCTAAAAGCAAGGTCCTTATTCTCCGGAACCATGGGCTCGTGTCTGTCGGAGAGAGCGTCGAGGAGGCCTTCTACTACATCCATAACCTCGTGGTTGCATGTGAGATCCAGGTTCGAACTCTGGCCAGCACAGGAGGGCCAGACAACTTAGTCCTCCTGGATCCTGGGAAGTACAAAGCCAAGTCCCGTTCCCCGGAGTCCCCGGCAGGGGAGGGCACCGGATCACCTCCCAAGTGGCTGATTGGTGAGCAGGAGTTTGAAGCCCTCATGCGGATGCTTGATAATCTGGGTTACAGGACTGGCTACCCTTACCGATACCCGGCTCTGAGAGAGAAGTCTAAAAAATGCAGCGACGCCGAGGTCCCTGCTGGTGTCGCAGGTCACTCCTTTGCTAGTGACGGCGATTCAGGCACTTGCTCCCCTCTCAGACACAGTTTTCAGAAGCAGCAACGCGAGAAGACAAGATGGCTGAACTCTGGCCGGGGCGACGATGCCTCTGAGGAAGGGCAGAATGGAAGCAGCCCCAAGTCGAAGACTAAGTGGACTAAAGAGGATGGACATAGAGCTTCCACCTCTGCTGTCCCTAACCTGTTTGTCCCATTGAACACGAACCCGAGAGAGGTCCAGGAGATGAGGAACAAGATCCGAGAGCAGAACTTGCAGGACATTAAGACGGCCGGGCCCCAGTCCCAGGTTTTGTGTGGTGTAGTGATGGACAGGAGCCTCGTCCAGGGGGAGCTGGTGACAGCCTCCAAGGCCATTATCGAGAAGGAGTACCAGCCCCACGTCATCGTGAGTACCGCAGGCCCCAACCCCTTCACCGCGCTGACGGACCGGGAGCTGGAGGAATACCGCAGGGAGGTGGAGCAGAAGCAGAGGGGCCCCGGAGAGAGTCTGGACGAGACGACGGAGCAGAGAGACGGCAGTCCGCCGGAGCCCCCTGCCGCTCCGCACACTCCCCCCAGCACCCCTGTTAAGCTGGAGGAAGACCTGCCGCAGGAGCCCGCTTCCGGAGACGACAGTGATGCCGCCACTTTCAAGCCAACTCTCCCCGACCTGTCCCCTGATGAGCCTTCAGAAGCGCTTGGCTTCCCAGCCCTGGAGAAGGAGGAGGAAGAGGGGCTTTGTGAAGCCCGTGGCCCTCCCGGCCCCACCAGGCCCCCCGCGGCGGCTAGCCCCGAGCCGGTCGCAGCCCAGGCGGCTGAAGAGGCTGCCTCCCCAGCGGCCGAGGACGGGGCTGCCGTGGATCCTGGCAGCGATGGGTCTCCAGGCAAGTCCCCGTCCAAGAAGAAGAAGAAGTTCCGCACCCCCTCCTTCCTGAAGAAGAGCAAGAAGAGGGGCGACTCCTGAAGGCCCGTCCCGCGCAGACCCATGCCACCGGACCGTCCCCGCCTGTGCCCCCCGCTGTCTTCTCGTGTAATGGAATGCAAAAAGCCCACCCCTCCGCATAGCTAGAGCCCCTTCCCGCCATGGCCAACGCCCACGCAGATGGGTGCTGACCTGCCCCCGGCCCTCAGCCTCAGGTCCCAGGGAGACCCAGCCCACGTCCACCTCCGTACTGTCTCACTGTTCCTCGGTGACGTGCTCTTGAGAGGCGTTCAGCCACGGTTCTGGCCAGACTGTCAGAGGCTCTGTGGTCTGGCCTTGACCCCTCTTGCTCTCCTGTCGTGCAGTGACCCATGCTGTCTGCTAGGCTCCCCTTCACCCCAAGGTCTCAGGTGACTGCTGAATCAGATGTGTAGCTTCCTGCCGGCGCTGTCTGCCCAGTGATCTCTCTTGGTTCACACACACAAGGCCTCAGTCCTGTGAAAACACCGTGTGCCTGCCAGCGGCCCAGGGCACCGTGGCGGCCTTTGGGAGGCGGGTCTGGGCCGAGCTGGAAACCCCAGCAGCGGACGGGCCTGTGTGCAGCCAATGCCACCTATGCATGGTCTAACCGGTTACCCCGCAGCCAGGAACGATTCAGGGCTCACAGCTCCTCACTCACTGGGGTCCTCAGGAAGGGAAGAGTCTTTTCTAGAATTTTCTTTCAGCACATGTGCGGTTCACCCCACACTTCTGTGAATACGAATGGCCACTTTTTGCTTTCGTTCTCTCTGGGGCCTGCTGCAGAGCAGCGGTCACCTGTTGTGGGGGAGGTTTCAGAACTGAGAGGGCTCTACTCCTACTGTAACTCAGCCCGAGCGACACCGTGGCTGCGGTCCAGGGCGGCTCAAGGCAGAAGTCGGCCCTAGGGGTCCCCACCTGACCCCGTGCCCCACGCCTGCCCTCCCTGCTCACACCAGTGTTCGCACTTAACTCAGATCCCCGGAAGGAGCGTCAGGCTGCTCAGTGGGAACTAGCGGGTGGCCACGGGGACTCCTCGAGGGTGACCCGTTGCAGGAGCTGCCCCGTGCCGACCTGACTAGGTGTGGGCAAGCCTGCCTGCTCCCCAGGCAGGCCCCCTGGGGACAGGCGGGGTCCTCGGTAGAGCTGGCACCTGACGGGGCTCGCGTCCCGCAGTCCGCACACCCGTGCGGGCCTCGAGGCTGGCCGCCGCTTCGAGCTCACGGCGAGCAAGCTGCTTTTCTCGTGTCGTTTTGTTGCCGAGGTGTGCTAAAGGCCCCATCGCGCCGTCCCTCAGTTAAGCACGGACTCTTCCGCTGTCACTTTCTTTGTCCCTCACACGCAGTGACTTTAATTTCACTTTTGTAGCGTAACCTCGTCACCACGTGCAGTGCAGTTGCGCGCGCAGACACGGGCCGGGAGGGCGAGCCCTGCGTCCTTCCTCCAGTGAACCGCGTTTTACTCACAAATAAAATTCTTTCAGCAGCTCCCTCGTCCGAACCTGGCGAGCACTTTCACGTGTTAA