Transcript asmbl_53217

Sequence
Transcript Sequence for observation asmbl_53217 of TGE0006121:
TGAGTTACTTGTACGTTATTTCAGCTCTTGAGGCCGTTGACCCCAGATTTCACTGTGCTGTGAAGAAAGCTGTGACATCATCTTTATTCTCAGTAAAAATCAAGGCTGCATGACATTTGCAAGAATGGATACATGAGTTCCATCTTACACGATGTACATGTTTTTCTCCTGAAGGGACATATGGTTTGTGCTTTTTAAACTCAGGAGCCTAGAAAGATTGTGCGATGAATGGTGATACTCGAGCCGTCGTGGTGACCTCACCACCCCCGACCACAGCCCCTCACAAGGAGAGGTACTTCGACAGAGTGGATGAGAACAATCCAGAATACCTGCGAGAGAGGAACATGGCCCCAGACCTTCGCCAGGACTTCAACATGATGGAACAGAAAAAGAGGGTGTCCATGATTCTGCAGAGCCCCGCCTTCTGTGAAGAATTGGAATCAATGATACAGGAACAATTTAAGAAGGGGAAGAATCCCACAGGCCTGTTGGCATTACAGCAGATTGCAGATTTCATGACCGCCAATGTACCCAGCGTCTACCCGGCAGCCCCACAGGGAGGGATGGCAGCCTTGAACATGAGTCTTGGTATGGTAACTCCTGTGAATGACCTTAGAGGATCTGATTCGATTGCCTATGACAAAGGGGAGAAATTACTGAGGTGTAAATTGGCAGCGTTTTACAGACTAGCAGATCTCTTTGGATGGTCTCAGCTTATCTACAATCATATCACAACCAGAGTGAGCTCCGAGCAAGAACACTTCCTCGTTGTACCTTTTGGACTTCTCTACAGTGAAGTGACTGCATCCAGTTTGGTGAAAGTCAGTCTGCAAGGAGATATCATAGACCGTGGAAGCACTAACCTGGGAATAAATCAGGCCGGCTTCATGTTACATTCTGCCATTTATGCTGCACGACCCGACGTGAAGTGCCTTGTGCACATTCACACAGCAGCGGGGGCTGCGGTCTCGGCGATGAAATGCGGCCTCTTGCCCATCTCTCCGGAGGCGCTTTCCCTTGGAGAAGTGGCTTACCATGATTATCATGGCATTCTGATTGACGAGAAGGAAAAAGTTTTAATTCAGAAAAATTTGGGGCCTAAAAGCAAGGTCCTTATTCTCCGGAACCATGGGCTCGTGTCTGTCGGAGAGAGCGTCGAGGAGGCCTTCTACTACATCCATAACCTCGTGGTTGCATGTGAGATCCAGGTTCGAACTCTGGCCAGCACAGGAGGGCCAGACAACTTAGTCCTCCTGGATCCTGGGAAGTACAAAGCCAAGTCCCGTTCCCCGGAGTCCCCGGCAGGGGAGGGCACCGGATCACCTCCCAAGTGGCTGATTGGTGAGCAGGAGTTTGAAGCCCTCATGCGGATGCTTGATAATCTGGGTTACAGGACTGGCTACCCTTACCGATACCCGGCTCTGAGAGAGAAGTCTAAAAAATGCAGCGACGCCGAGGTCCCTGCTGGTGTCGCAGGTCACTCCTTTGCTAGTGACGGCGATTCAGGCACTTGCTCCCCTCTCAGACACAGTTTTCAGAAGCAGCAACGCGAGAAGACAAGATGGCTGAACTCTGGCCGGGGCGACGATGCCTCTGAGGAAGGGCAGAATGGAAGCAGCCCCAAGTCGAAGACTAAGTGGACTAAAGAGGATGGACATAGAGCTTCCACCTCTGCTGTCCCTAACCTGTTTGTCCCATTGAACACGAACCCGAGAGAGGTCCAGGAGATGAGGAACAAGATCCGAGAGCAGAACTTGCAGGACATTAAGACGGCCGGGCCCCAGTCCCAGGTTTTGTGTGGTGTAGTGATGGACAGGAGCCTCGTCCAGGGGGAGCTGGTGACAGCCTCCAAGGCCATTATCGAGAAGGAGTACCAGCCCCACGTCATCGTGAGTACCGCAGGCCCCAACCCCTTCACCGCGCTGACGGACCGGGAGCTGGAGGAATACCGCAGGGAGGTGGAGCAGAAGCAGAGGGGCCCCGGAGAGAGTCTGGACGAGACGACGGAGCAGAGAGACGGCAGTCCGCCGGAGCCCCCTGCCGCTCCGCACACTCCCCCCAGCACCCCTGTTAAGCTGGAGGAAGACCTGCCGCAGGAGCCCGCTTCCGGAGACGACAGTGATGCCGCCACTTTCAAGCCAACTCTCCCCGACCTGTCCCCTGATGAGCCTTCAGAAGCGCTTGGCTTCCCAGCCCTGGAGAAGGAGGAGGAAGAGGGGCTTTGTGAAGCCCGTGGCCCTCCCGGCCCCACCAGGCCCCCCGCGGCGGCTAGCCCCGAGCCGGTCGCAGCCCAGGCGGCTGAAGAGGCTGCCTCCCCAGCGGCCGAGGACGGGGCTGCCGTGGATCCTGGCAGCGATGGGTCTCCAGGCAAGTCCCCGTCCAAGAAGAAGAAGAAGTTCCGCACCCCCTCCTTCCTGAAGAAGAGCAAGAAGAGGGGCGACTCCTGAAGGCCCGTCCCGCGCAGACCCATGCCACCGGACCGTCCCCGCCTGTGCCCCCCGCTGTCTTCTCGTGTAATGGAATGCAAAAAGCCCACCCCTCCGCATAGCTAGAGCCCCTTCCCGCCATGGCCAACGCCCACGCAGATGGGTGCTGACCTGCCCCCGGCCCTCAGCCTCAGGTCCCAGGGAGACCCAGCCCACGTCCACCTCCGTACTGTCTCACTGTTCCTCGGTGACGTGCTCTTGAGAGGCGTTCAGCCACGGTTCTGGCCAGACTGTCAGAGGCTCTGTGGTCTGGCCTTGACCCCTCTTGCTCTCCTGTCGTGCAGTGACCCATGCTGTCTGCTAGGCTCCCCTTCACCCCAAGGTCTCAGGTGACTGCTGAATCAGATGTGTAGCTTCCTGCCGGCGCTGTCTGCCCAGTGATCTCTCTTGGTTCACACACACAAGGCCTCAGTCCTGTGAAAACACCGTGTGCCTGCCAGCGGCCCAGGGCACCGTGGCGGCCTTTGGGAGGCGGGTCTGGGCCGAGCTGGAAACCCCAGCAGCGGACGGGCCTGTGTGCAGCCAATGCCACCTATGCATGGTCTAACCGGTTACCCCGCAGCCAGGAACGATTCAGGGCTCACAGCTCCTCACTCACTGGGGTCCTCAGGAAGGGAAGAGTCTTTTCTAGAATTTTCTTTCAGCACATGTGCGGTTCACCCCACACTTCTGTGAATACGAATGGCCACTTTTTGCTTTCGTTCTCTCTGGGGCCTGCTGCAGAGCAGCGGTCACCTGTTGTGGGGGAGGTTTCAGAACTGAGAGGGCTCTACTCCTACTGTAACTCAGCCCGAGCGACACCGTGGCTGCGGTCCAGGGCGGCTCAAGGCAGAAGTCGGCCCTAGGGGTCCCCACCTGACCCCGTGCCCCACGCCTGCCCTCCCTGCTCACACCAGTGTTCGCACTTAACTCAGATCCCCGGAAGGAGCGTCAGGCTGCTCAGTGGGAACTAGCGGGTGGCCACGGGGACTCCTCGAGGGTGACCCGTTGCAGGAGCTGCCCCGTGCCGACCTGACTAGGTGTGGGCAAGCCTGCCTGCTCCCCAGGCAGGCCCCCTGGGGACAGGCGGGGTCCTCGGTAGAGCTGGCACCTGACGGGGCTCGCGTCCCGCAGTCCGCACACCCGTGCGGGCCTCGAGGCTGGCCGCCGCTTCGAGCTCACGGCGAGCAAGCTGCTTTTCTCGTGTCGTTTTGTTGCCGAGGTGTGCTAAAGGCCCCATCGCGCCGTCCCTCAGTTAAGCACGGACTCTTCCGCTGTCACTTTCTTTGTCCCTCACACGCAGTGACTTTAATTTCACTTTTGTAGCGTAACCTCGTCACCACGTGCAGTGCAGTTGCGCGCGCAGACACGGGCCGGGAGGGCGAGCCCTGCGTCCTTCCTCCAGTGAACCGCGTTTTACTCACAAATAAAATTCTTTCAGCAGCTCCCTCGTCCGAACCTGGCGAGCACTTTCACGTGTTAA