Transcript asmbl_52164

Sequence
Transcript Sequence for observation asmbl_52164 of TGE0006087:
GCCGTCTTGTGCGGGAGGCTTGTCCCTCCCTACCTGCTGCTCCAGGCTGAGGCTTCCCTAGTGCATCTGTCCGCCGATTCATGATTTTCTGCCGTTTCTTGGCAAAAATGGCAAACAATGATGCTGTTCTGAAAAGACTGGAACAGAAAGGTGCAGAGGCAGATCAAATTATTGAATATCTTAAGCAGCAAGTTGCTCTTCTTAAGGAAAAAGCAGTTTTGCAGGCAACTTTGAGAGAAGAGAAGAAACTTCGAGTTGAAAATGCTAAGTTGAAGAAAGAAATTGAAGAATTGAAGCAAGAACTAATTCAGGCAGAAATTAAAAATGGAGTGAAACAAATACCATGTCCACCTAGTACTCTACTGCAAGCTAATTCCACGGTTTCTGAAAATGTGATGCAGTCCGTACTATTAACAACCATGTCTTCTGGTACCAAAGAACAGATAAAAGGAGGAGGAGAAGAAGCAAAGAAGGTGAAAGAGAAAATTGAAAAGAAAGGAGAGAAAAAGGAGAAGAAACCTCAATCAGTAGCAGGAGGTGCTGACTCTAAGCCAATAGATGTTTCCCGTCTGGATCTTCGCATTGGTTGTATCATCACTGCCAAAAAACATCCTGATGCAGATTCTTTGTATGTAGAAGAAATAGATGTTGGAGAAGCAGCCCCAAGAACAGTTGTCAGTGGCCTGGTAAACCATGTTCCTCTTGAACAGATGCAAAATCGGATGGTGATTTTACTTTGTAACCTAAAACCTGCAAAGATGAGGGGAGTACTATCTCAAGCAATGCTGATGTGTGCTAGTTCACCAGAGAAAGTTGAAATCTTGGCACCTCCTAATGGGTCTGTTCCTGGAGACAGAATTACTTTTGATGCTTTTCCTGGAGAGCCTGATAAAGAGCTGAATCCTAAGAAGAAGATTTGGGAGCAGATCCAGCCTGATCTTTACACTAATGATGAGTGTGTGGCTACATACAAAGGAGCTCCCTTTGAGGTGAAAGGGAAGGGAGTGTGTAGGGCTCAAACTATGACGAACAGTGGAATAAAATAAAATTAGAATGCTTCAGTTACTGAAATACATTGGAAAAAACTTTAATAACAATAAAAAGAAATACATTTGTCACTTATACCTAAAATATAACTGGCTCTTTGTGCGCTTTCTCTTCTAGACTTAACTAGTCTTTTACCTGGTGTATATTATTTTCAGTTGATTAGAAAA