Transcript asmbl_13414

Sequence
Transcript Sequence for observation asmbl_13414 of TGE0000154:
ACGCAAGTCTGGGTCCTTCGGCGATTGACCGGGGTCCTTGCTGTTCGGGAGCCTCTCCTAAGCTGCCTGTTCGCGCGAGAGTTTGGAGGGGCGGGTTTGGGGTCGGTGTCTGATTGGGGCTCGCACCGCAGCACGCTGGAGTCCCGCTTAGGTACCAGTTAGCGTCAGGGGAGCTGGGTCAGGCGGTCGCCGGGACACCCCGTGTGTGGCAGGCGGCGAAGCGCTCTGGAGAATCCCGGACAGCCCTGCTCCCTGCAGCCAGGTGTAGTTTCGGGAGCCACTGGGGCCAAAGTGAGAGTCCAGCGGTCTTCCAGCGCTTGGGCCACGGCGGCGGCCCTGGGAGCAGAGGTGGAGCGACCCCATTACGCTAAAGATGAAAGGCTGGGGTTGGCTGGCCCTGCTTCTGGGGGCCCTGCTGGGAACCGCCTGGGCTCGGAGGAGCCAGGATCTCCACTGTGGAGCATGCAGGGCTCTGGTGGATGAACTAGAATGGGAAATTGCCCAGGTGGACCCCAAGAAGACCATTCAGATGGGATCTTTCCGGATCAATCCAGATGGCAGCCAGTCAGTGGTGGAGGTGCCTTATGCCCGCTCAGAGGCCCACCTCACAGAGCTGCTGGAGGAGATATGTGACCGGATGAAGGAGTATGGGGAACAGATTGATCCTTCCACCCATCGCAAGAACTACGTACGTGTAGTGGGCCGGAATGGAGAATCCAGTGAACTGGACCTACAAGGCATCCGAATCGACTCAGATATTAGCGGCACCCTCAAGTTTGCGTGTGAGAGCATTGTGGAGGAATACGAGGATGAACTCATTGAATTCTTTTCCCGAGAGGCTGACAATGTTAAAGACAAACTTTGCAGTAAGCGAACAGATCTTTGTGACCATGCCCTGCACATATCGCATGATGAGCTATGAACCACTGGAGCAGCCCACACTGGCTTGATGGATCACCCCCAGGAGGGGAAAATGGTGGCAATGCCTTTTATATATTATGTTTTTACTGAAATTAACTGAAAAAATATGAAACCAAAAGTACAAACTGTGTTGTCTTTTCATGCCTGGAATTGCCCTTACATTAAGCTTGAAGATAAGGAGTTATATAGACAGGAAAGATAATGGAGGAGAAAGAAGAGTTTTGGGATTGATACAGGATAAAGGTAGGAGAGGCCTGAACCTTTAATTCTTCTACCTTCTGAGATTCCACTCCACTCATAAACTAGATAAGCTTTCAGTCAGTGCCCACTCAATACCACGTCTTTAGAGTCTAATTGTGGAGAATAGAGGAACCTCCATGAGGAAGCAGGGGAACATAGTGTATGGTAGTGTAGAATTCTAGAAATCCCTTGTGTTCATGGCTGTTGAAACATAAAGTAAGACAGGGCTTGGTCTTGAAGGAAATAACGGATATGCATTATTCTTCCTTCCCTGCCCATCCAGATGGAGGGACCAGCAAGAACAGAGACAGGAAGGGGAAAATGGATGTGACCAACTCAGCTGAAAAGTAAGGGCTTTATCGGATAGGGACAGACGAGGTAAGGAAGGTTGTTTAATGAGAGGCCTTGCTTGCCAGCCTAAGCTTTTAAATTTGATGCCAGTGGCAACAATAAAGTGTATCTATCACTAGCCATTGTCAATCTGGACTATAAGTCTGTCCACAATTCTGTGTGTAGAGATTCCAGACTGGGGCATAGGGATGAAAACCTAAAGGATA