Transcript asmbl_51976

Sequence
Transcript Sequence for observation asmbl_51976 of TGE0006078:
CCGCTGTAGTCTCGCGCGGCGGTTGCGAGCGCGTGAGGGACCTGTGCTGCGTTGCGTGCGGTTAGGCAGCAGCGGCAGCAGGAGCAGCAGCAGCTGTGTATAGGAGTCATGAAACACCACGAGGTGGAGATTCTGGACGCGAAGACACGGGAGAAGCTGTGCTTCTTGGACAAGGTGGAGCCCCATGCCACCATCGCCGAGATCAAGAATCTTTTCACTAAGAGCCATCCGCAGTGGTACCCTGCCCGCCAGTCCCTCCGTCTGGACCCTAAGGGCAAGTCCCTGAAGGATGAGGATATTCTGCAGAAGCTGCCTGTGGGTACCACGGCCACACTTTACTTCCGAGACCTGGGGGCCCAGATCAGCTGGGTGACGGTGTTCCTGACAGAGTACGCGGGGCCCCTTTTCATCTACCTGCTCTTCTACTTCCGGGTGCCCTTCATCTATGGCCACAAATATGACTTCACGTCCAGCCGGCACACGGTGGTGCACCTCGCTTGCATCTGCCACTCATTCCACTACATCAAGCGCCTTCTGGAGACACTCTTCGTGCATCGCTTCTCTCATGGCACCATGCCCTTGCGCAACATCTTCAAGAACTGCACCTACTACTGGGGCTTCGCTGCGTGGATGGCCTATTACATCAACCACCCTCTCTACACGCCCCCCACCTATGGAGCTCAGCAGGTTAAACTGGCACTTGCCATCTTTGTGATTTGTCAGCTGGGCAATTTCTCCATCCACATGGCCCTGCGGGACCTGCGGCCAGCAGGGTCCAAGACCAGGAAGATCCCCTACCCCACTAAGAACCCCTTCACATGGCTTTTCCTGCTGGTGTCCTGCCCCAACTACACCTATGAGGTGGGGTCCTGGATTGGCTTTGCCATCATGACACAGTGTCTCCCAGTGGCCCTCTTCTCCCTGGTGGGCTTCACCCAGATGACTATCTGGGCCAAGGGCAAGCACCGCAGCTACCTGAAGGAATTCCGAGACTACCCACCCCTGCGCATGCCCATCATCCCCTTCCTGCTCTGAGCTGCCCACCCCACTGGCTAGGCTCCGCCAGGCTTTCATCCCCCCACCCCTTGTCCTTTTGGGAGAGAAGTGAGGACCACTGCTCTTCAGCGCATGGAATAAAACCTGCCTGCATAGCCGGA