Transcript asmbl_51933

Sequence
Transcript Sequence for observation asmbl_51933 of TGE0006067:
GGCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCCGCGTCGCTCGGGCCCCGCCATGGCCGTCACCATCACACTCAAAACGCTGCAGCAGCAGACCTTTAAGATCCGCATGGAGCTTGACGAGACGGTGAAGGTGCTAAAGGAGAAGATAGAAGCTGAGAAGGGACGTGATGCCTTCCCCGTGGCTGGACAGAAACTCATTTATGCTGGCAAGATCCTGAGTGATGATGTCCCTATCAGGGACTATCGCATAGATGAGAAGAATTTTGTGGTTGTCATGGTGACCAAGGCTAAAACCAGCCCAGGCACATCAGTACCCCCAGAGGCTTCACCCACTGCTGCTCCAGAGTCCTCCACGTCCTTCTCGCCAGCCCCTGCTTCAGGCATGTCCCATTCCCCACCTACCGCCAGAGAAGACAAGAGCCCATCGGAGGAATCGGTCCCCACGACATCCCCGGAGTCTGTGTCAGGCTCTGTTCCTTCTTCAGGTAGCAGCGGGCGAGAGGAAGACGCGGCCTCCACACTAGTGACTGGCTCTGAGTATGAGACGATGCTGACGGAGATCATGTCCATGGGCTATGAGCGGGAACGGGTCGTGGCCGCCCTGAGAGCCAGCTACAACAACCCCCACCGAGCCGTGGAGTATCTGCTCACGGTGAGGTGGGGCTGCTGCCTCCTTGGGAGGCTTTCAAGGAATACCTGGGCTTCAGCACCCTGATGGGTGGTCAGGAAGACAAACCCTGCCCCCCGAAGCCTTTGGGTCATGGTACCAGCCAGGAAAGGCTTCTTGTAGGAGGCCAGACATGGGCAGAGAGGTGGGCCCGTGGAGGGCGGGGCTGACGTCTCACCTGTCTCCTGCCAGAGCTGAGTGTGCAGGAGGGAGGCAGCGGGTGGTCTGTGCATTAGAACTAAATAGGACCCCTGACAGGGAATTCCTGGGAGCCCCGAGCCAGAACATGGTTCTGTCCAGGAGAGCCAGGTGTCCGAGCAGCCAGCTACAGAAGCAGCGGGAGAGAACCCCCTGGAGTTTCTGCGGGACCAACCCCAGTTCCAGAACATGCGGCAGGTGATTCAGCAGAACCCGGCGCTTCTGCCTGCACTGCTCCAGCAGCTGGGCCAGGAGAATCCACAGCTTTTGCAGCAAATCAGCCGGCACCAGGAGCAGTTTATTCAGATGCTGAATGAGCCTCCTGGGGAGCTAGCAGACATCTCAGATGTGGAGGGTGAGGTGGGTGCCATAGGCGAGGAGGCCCCGCAAATGAACTACATCCAGGTGACGCCGCAGGAGAAAGAAGCTATAGAAAGGTTGAAGGCCCTGGGCTTCCCAGAGAGTCTGGTGATTCAGGCCTACTTCGCCTGTGAAAAAAACGAGAACTTGGCTGCCAACTTTCTCCTGAGTCAGAACTTTGATGACGAGTAATGCCGGGAGGCCAGGCTGCCTACCGCCCCACCCCTAACCCCAACTCCAAAAAAGTTTTATAAAAGAAAAAATATATATATATATTCATGTTTATTTAAGAAGTGGAAAAAAATCAAAAACCTTAAAAAAAAAACAGAAAAAAAACACCTCAATTTCCACCCTCCTCAAATGGCCCCCATTCCCATCTTGGCCTGAGAAGACCTGGGCCAGACAGCTGTCCTCCCATCCCCCACCCCAGCCTGCTTCAAGGAGCTGGCAGGACCGGAGGTGACAGATGGGCCCCTCTTGGCCTCTGTCCCAGCTCCCTGCAGCCAGATGGAGAGGCGGCTGCTTGCTTCCCCATCCCCCAAAGCCTGAGACCACCCCCACCCTCTTTCAGGGTGACGGGAAGCCAGAGCCCCAAACTTTGATCCTCCATTGGAGTGGTCCAAATCTTTCCATCTGGGGTGAGCAGTCAGAGACCCAAGTCCCACTCTGCAGTCTGGTCTTGGCTTCCAGCCTGCATCCCTTCACTGGGGAGGAGGCGGCCAGGTTTGTCCTAAGGAAGGGGTAACATCAGAGCTGTTCTAGAAGTCAAGGCCACCCCCACCCCAGAACAGAACCGTGTCTCTGATAAAGGTTTTGAAGTGAATAAAGTTTTAAAAGCCCA