Transcript asmbl_51241

Sequence
Transcript Sequence for observation asmbl_51241 of TGE0006023:
GGAAGTGCAGCCAAGAACCCCTGTGCAGTGTGGAGGTCGTAGGAGTCACTTACTCACCGCCAGGTCCTTCGCTTGCTGGTCCGCGCCCCGCCCGCCGCAGCCATGCTCTCAGCCCTTGCCCGGCCTTCCGGCGCCGCTCTCCGCCGCAGCTTCAGCACCTCGGCCCAGAACAATGCTAAGGTAGCCGTGCTCGGGGCTTCTGGAGGAATTGGGCAGCCCCTTTCACTTCTCCTGAAGAACAGTCCTTTGGTGAGCCGCCTGACCCTCTACGATATTGCTCATACGCCTGGAGTGGCGGCGGATCTGAGCCACATCGAGACCAGAGCAAATGTGAAAGGCTACCTCGGACCTGAGCAGCTGCCCGAATGCCTGAAAGGTTGTGATTTGGTGGTTATTCCAGCCGGAGTCCCAAGAAAACCAGGCATGACACGGGATGACCTGTTCAACACCAATGCCACAATTGTGGCCACCTTGACTGCTGCGTGTGCTCAACATTGCCCTGACGCCATGATCTGTGTCATTGCAAATCCGGTCAACTCCACCATCCCAATCACGTCAGAAGTTTTCAAGAAACATGGAGTATACAACCCCAGTAAAATCTTTGGGGTGACGACCCTGGATATTGTCAGAGCCAACACTTTTGTTGCAGAACTGAAGGGTTTGGATCCAGCTCGAGTCAATGTCCCTGTCATTGGCGGCCATGCTGGGAAGACCATCATCCCCCTGATCTCTCAGTGCACTCCCAAGGTGGACTTTCCCCAGGACCAGCTGACAGCGCTTACTGGGCGGATCCAGGAGGCTGGCACGGAGGTGGTCAAGGCTAAAGCTGGAGCAGGCTCTGCCACCCTGTCCATGGCATATGCCGGAGCCCGGTTTGTCTTTTCCCTTGTGGATGCAATCAACGGAAAGGAAGGAGTGGTTGAATGTTCTTTTGTTAAATCCCAAGAAACGGACTGTCCCTATTTCTCCACACCATTGCTGCTTGGAAAAAAGGGCATCGAGAAAAATCTAGGCATTGGCAAAGTTTCCCCTTTTGAAGAGAAGATGATAGCTGATGCCATTCCTGAGCTGAAAGCCTCAATCAAGAAAGGAGAAGAGTTTGTGAAGAACATGAAATGAGAAAACTGTTAGCAGGCAGTCCATTTCCTTAACTTATTAAGGCATTCTGTCACTGTAAAGCATTTCAGATTTCTTTGTATTTCATTTTGCTTTAACGATGAATATTGTATTAATGTTACCATCCCTTCCTAGTTGCGGATCAGTCTATTGGTGCATCAATAAAAGTAGGCTTTGATTTTCTTTTTCAAGGTCTCTGCCATAAATATTGTGCTTTCTTCCCTACTAGAGCTGACTTGAGTGTCTGGCATTTCTTTGATCACAAATCAATACTAGATGTTATTTAAATATTAGACTGAAGCAAGATGATCTCATTTGTAGCTTCAAAGAAGTCTGAAATATTTATCAGTAGTTGCTCCTCCCAGACCTGCTCTGCACCATTGCATCCCTCAGGTGTGTAAACTGAAAGAAGAGTCTGCTCAGGCCAATTCCTCGGTGTCCTTTCACCTGCGAGGAGTAATAGCTCAGTGACTGATGATAAGTCGCTATTTGTTGTCCCTGGTTCTTCCTGTGTGCTATTTTTC