Transcript asmbl_51137

Sequence
Transcript Sequence for observation asmbl_51137 of TGE0013289:
TTTAGTTCTAGTTAGAGCGGCGCGGGGAGTAGTTTGTAGTTCGAGGCGCCGTTCCGCGAGTGACGCAGGCGCTACGCGAGTGGCGCGCGCCGACTGCCCGTCCTCTGCTGTCCCCCTTTCTTCGCGTCTCGGCCCCGTAGCTTAGAGCGTCTTGTTTCTTTCTCACCCTCTGCGTCGTTTTCATCGCGCGCCAGAGGCAAGGGGCGGGCCTAGGTATCCTTGAGAACCAGCTAGCCGGAGCTCGAGACTAACGGCCGCGACTCCTCCCAGGCCTCTTCAGACCGCGTCATGGGTGACAGTGACGACGAGTACGATAGAAGGCGCAGGGACAAGTTTAGAAGAGAGCGCAGCGACTATGACCGTTCGCGGGAAAGAGATGAAAGACGTCGAGGGGACGATTGGAATGACCGAGAGTGGGACCGTGGCCGGGAGCGCCGTAGTCGGGGTGAATATCGTGACTATGACCGGAATCGGCGAGAGCGCTTCTCTCCTCCTCGCCATGAGCTCAGCCCCCCACAGAAGCGCATGAGGCGAGACTGGGATGAGCACAGCTCTGACCCATACCACAGTGGCTATGAGATGCCCTATGCTGGGGGGGGTGGGGGCCCAACTTATGGCCCCCCTCAGCCCTGGGGCCACCCAGACGTCCACATCATGCAGCATCATGTTCTGCCTATCCAGGCCAGGCTGGGCAGCATAGCAGAGATTGACTTGGGTGTGCCACCACCGGTGATGAAGACGTTCAAGGAATTTCTCCTTTCGTTGGATGACTCTGTGGATGAGACAGAGGCAGTTAAGCGCTATAATGACTATAAGCTGGATTTTCGAAGACAGCAGATGCAGGATTTCTTCCTGGCTCATAAGGATGAGGAGTGGTTTCGGTCTAAGTACCACCCAGATGAGGTGGGGAAGCGTCGGCAGGAGGCTCGGGGGGCCCTGCAAAACCGACTGAGAGTATTTCTTTCCCTCATGGAGAGTGGCTGGTTTGATAATCTTCTTCTGGATATAGACAAAGCCGATGCCATTGTTAAGATGCTGGATGCAGCTGTAATTAAGATGGAAGGAGGTACAGAGAATGATCTACGCATCCTGGAGCAAGAGGAGGAAGAGGAACAGCCAGGAAAGCCCGGAGAGCCCAGCAAGAAAGAGGAAGGCCGGATTGGACCAGGCCCGGTGGATGGGGAGCGCAAGGCCAATGAGAAGGAAGACAAGAAGGAAGATGGCAAACAGGTCGAAAATGACAGTTCTAGTGATGACAAAACTAAGAAATCTGAGGGTGATGTGGACAAGGAAGAGAAGAAAGAAGATTCTGAGAAAGAAGCCAAAAAGAGTAGCAAGAAGCGGAATAGGAAGCATAGTGGTGACGACAGCTTTGATGAAGGCAGTGTGTCCGAGTCAGAGTCAGAATCTGAGAGTGGCCAAGCTGAGGAAGAGAAGGAGGAGGCTGAAGCAGCGCTCAAGGAAAAGGAGAAGCCCAAGGAAGAAGAAAGGGAGAAGCCCAAGGACACTCCTGGGCTGGAATGTAAACCCCGGCCCCTGCATAAGACTTGTTCTCTCTTCATGCGCAACATCGCACCCAACATCTCCCGGGCTGAGATAATTTCTCTTTGTAAAAGATATCCAGGTTTTATGCGTGTGGCACTATCAGAGCCCCAGCCTGAGAGGAGGTTTTTCCGTCGTGGCTGGGTGACATTTGACCGCAGTGTTAACATCAAAGAGATCTGTTGGAACCTGCAGAATATCAGAGTGAGTGCTGGGAGCGGGACTGTTTTAAGGGAGAGAAAGTGTGGCTCTCCT