Transcript asmbl_50577

Sequence
Transcript Sequence for observation asmbl_50577 of TGE0005978:
GTTTTGCAAGACTTGTTTCACTTTGTTTTGGACAAGGCTGAGACTCATATTTCAAACAAAAGGCAGCCAATTACTAACATCTGGTTGCTGGGTGTGGTCTCCTTTCAAATTCTATAAAATCTGAAGCCCAAGGCTTCACTTCCAGTGTGAAACAGTCGGAGAAGAATCTCTCTTTAGCTTCTGAAAAGAAGGTGGAAAAAAAGAAACTTCTTCAAAAATGTCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATACGTTAAAACTGTGAAAGCATCCAAAGGTGGTCCTGGGTCAGCAGTGAGCCCCTATCCTAGCTTCAATCCATCCTCAGATGTCGATGCCTTGCATAAAGCAATCATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGAGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAAAAGGAAAGCCCCTGGATGAAGTTCTGAAGAAAGCCCTGACAGGTCACCTTGAAGAAGTTGCTTTGGCTCTATTAAAAACTCCAGCCCGGTTTGATGCTGATGAACTGCGTGCTGCCATGAAGGGCCTTGGAACAGATGAAGAGACTCTGGATGAAATTTTGGCATCAAGAACTAACAGAGAAATCAGAGAAATTAACAGAGTCTATAGAGAAGAATTGAAGAGAGATCTGGCTAAAGACATCACCTCAGACACATCTGGAGATTATCAGAAGGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGATATTGGCATAAATGAGGACTTGGCTGATTCAGATGCCAGGGCATTATATGAAGCAGGAGAAAGGAGAAAAGGGACAGATGTGAATGTGTTCACTACCATTCTTACCACCAGAAGCTACCCCCATCTTCGCAGAGTGTTTCAGAAGTACACCAAATACAGTCAGCATGACATGAACAAAGTTCTGGATCTGGAGATGAAAGGTGATATTGAGAAGTGCTTCACAACCATCGTGAAGTGTGCCACTAACAAACCAATGTTCTTTGCTGAGAAGCTTCATCAGGCCATGAAGGGTGCTGGAACGCGTCATAAGGCATTGATCAGAATTATGGTTTCCCGTTCTGAAATCGACATGAACGATATCAAAGCCTGCTATCAGAAGTTGTATGGTATCTCTCTCTGCCAAGCCATTCTGGATGAAACCAAAGGAGATTATGAAAAAATCCTGGTGGCTCTCTGCGGAGGACAGTAAATATTCCTTTAATGATCTCAAGCTTTTTGATCAGAAGATTTTTTAATCATATCTTTTCATTCCATATTACAGACTTAAATAGAAAAGTTTGTTCAGCAGAATTAGTTAGCTAACTGCTTTCTGAAAACTATGGCTTATAAATCATTTTTATATCATAACTCTGTATAATAGAGATAAGTTTTTTAAAAATTTATTTACCCCAATTATAAAACCCCACGAACAGGTTGTTCTAGTACCATTACTTGAGAAAGATGTTTATGTAACAGAAAATAAAATGATTTTACAGGACAATTGGTGTGTCATTGGTTCTTCTATTCTGATTTTTTTCTATGTGTAATGTAGTGGTTTAATTTGATATAAGGAGATAGGAACTTGAATTCTAAATTATAATTATTTAATGAAATAA