Transcript asmbl_50541

Sequence
Transcript Sequence for observation asmbl_50541 of TGE0005972:
CTCCATTCTGCGGTCCCAGAGCTTGAAGGCCTCTGCCACGGTCACCGTGACCCCGCGCCTCTGCCGCCCCCCGGCAGGTGTGATCTCCCCTGAGGACCACAGGGAAGCTCATCTCCCTGCTTGGCTTCTACCTTTAACTCTTGGGAGCATCCCCTAACACATCCAAACTACAATCCAGACCCAAGAGGGCAAAGTCCAGAAAGAGGTCAAGATGGGGTTTATATTTTCAAAAGCTATGAATGAAAACATGAAAAACCAACAGGAGTTTGCGTTAATGAATGCTCGACTTCAGCTAGAAAGGCAGCTAATAATGCAGAATGAAATGAGAGAAAGACAAATGGCCATGCAGATTGCTTGGTCTCGAGAATTCCTCAAATATTTCGGAACATTTTGTAGCCTTGCAGCAATCTCTTTAACAGCTGGAGCAATAAAAAGGAAGAAGCCAGCCTTCCTCTTTCCTCTTGTTCCATTAGGCTTTGTCTTTACCTACCAGTATGATTTAGGCTATGGAACCCTTCTACAAAGAATGAAAGGTGAAGCCGAGAACATACTGGAATCAGAAAAGAGTACATTGCAGTTGCCAAAAGGAATGATTACTTTCGAAAGCCTTGAACAAGCCAGAAAGGAACAAAGTAAATTCTTCATAGACAAATGAAATCATGTTTACCCACCAAATCTCAAAACACAGAATTGTTGACTCGAATCATGGTTTTTACAATTTCTTAAATGCTCGAGATCTTGATGTAATGGATTTTATTTTTAAATTTTAAAAATCAGTTTTGTTAAACTATTTTAAAGTAAAATTTATAACATTCAACAAAAAATGGAGGTTCTCTAAGTAACTTTCAGATTTCCTATATGTGTGTGTGTGTATAATAAATAAATGTGAAATTAATAAACTATGTTGTTTTGAATTCCTG