Transcript asmbl_50506

Sequence
Transcript Sequence for observation asmbl_50506 of TGE0005969:
GCAGGCTTGTCGGGACATCCAAGGCATTCCCTCAGCTTCTGCCGCCCCGGGATCCTCGGCTCTGGTCCGTCTCCCTGCATCTTCCCGCTGTACCGCTGCACCTCCTCCCTCCTGGGCTTCGGACCCCGGGCATCGCCCCTCCTGAAACATGACTCGCGATTTCAAACCTGGAGACCTCATCTTCGCCAAGATGAAAGGTTATCCTCATTGGCCAGCTCGAGTAGATGAAGTTCCTGATGGAGCTGTAAAACCACCTACAAACAAACTACCCATTTTCTTTTTTGGAACTCATGAGACTGCTTTTTTAGGCCCAAAGGATATATTTCCTTACTCAGAAAATAAGGAAAAGTACGGAAAACCAAATAAACGAAAAGGCTTTAATGAAGGTTTATGGGAGATAGATAACAATCCGAAAGTGAAATTTTCAAGTCAACAGGCATCAGCTAAACAATCAAATGCATCATCTGATGTTGAAGTTGAAGAAAAAGAAACTAGTGTTTCAAAGGAAGATACTGACCATGAAGAAAAAGGCAGCAATGAGGATATGACTAAAGCAATTGACATAACTACGCCAAAAGCTGCCAGAAGAGGGAGAAAGAGAAAGGCAGAAAAGCAAGTAGAAACCGAGGAGGCAGGAGTAGTGACAACAGCAACAGCATCTGTTAATCTAAAAGTGAGTCCTAAAAGAGGACGACCTGCAGCTACAGAAGTAAAGATTCCAAAACCAAGAGGCAGACCCAAAATGGTAAAACAGACCTGTCCTTCAGAGAGCGACATGGTAACTGAAGAAGACAAAAGTAAGAAAAAAGGGCAAGAGGAAAAACAACCTAAAAAGCAGCTTAAAAAGGATGAAGAAGGCCAGAAGGAAGAAGATAAACCAAGAAAAGAGCCAGATAAAAAAGAGGGGAAGAAAGAAACTGAATCAAAAAGGAAAAATTTAGCTAAAACGGGGGTCACATCAACCTCCGATTCTGAAGAGGAAGGAGATGATCAAGAGGGTGAAAAGAAGAGAAAAGGTGGAAGAAACTTTCAGACTGCTCATAGAAGGAATATGCTGAAAGGCCAACATGAGAAAGAAGCAGCGGATAGAAAACGCAAGCAAGAGGAACAAATGGAAACTGAGCAGCAGAATAAAGATGAAGGAAAGAAGCCAGAAGTTAAGAAAGTGGAGAAGAAGCGAGAAACATCAATGGATTCTCGACTTCAAAGGATACATGCTGAAATAAAAAATTCACTCAAAATTGATAATCTTGATGTGAACAGATGTATTGAAGCCTTGGATGAACTTGCTTCACTTCAGGTAACAATGCAACAAGCTCAGAAACACACAGAGATGATTACAACACTGAAAAAAATACGACGATTCAAAGTGAGTCAGATTATCATGGAAAAGTCTACAATGTTGTATAACAAGTTTAAGAACATGTTTTTGGTTGGTGAAGGAGATTCTGTAATCACACAAGTGCTGAATAAATCTCTGGCTGAACAAAGACAGCATGAGGAAGCAAATAAAACCAAAGATCAAGGGAAGAAAGGGCCAAACAAAAAGCTAGAAAAGGAACAAACAGGTTCAAAGACTCTAAATGGAGGATCTGATGCTCAAGACAGTAATCAACCACAGCATAATGGAGATAGCAATGAAGAAAGCAAAGACGAGGCCAGCAGTAAGAAAAAGTGAGGACATGTTTTAATGGGTCGTAATGTGTACTTTTTGTTTAATTTTTAAATCACAGTGTTGTTCCAAGGTTATTTGTAGTAAGGTATTATATTTTGATCACTCAGTTCCTGAATTCAGAAAGCAAGTTACAAATCAAAAAGATGTAGAAATTAAGTTATAACTAATTTCACTGTATTCAAGGGAATAGAGCGAGGCAGGAATTTTAGTTTTAAAAAATAATTTTTGGACTTCTT