Transcript asmbl_50337

Sequence
Transcript Sequence for observation asmbl_50337 of TGE0005949:
ATAGTGCACTATCTGTGCAGACAGGACGGGAGACCGCGGTGTCGTTTAGCAGAGCAGAACCGAGTTGAGAAGGTCAGGCTCATCTAGAGGGTGTCGGCGGAAACATGGAGAAACGACTCACATATGAAGATTGTCAGTACACTGCAGAATGGCTTCTGTCCCACACCAAGCACCGACCTCAAGTGGCAGTGATCTGCGGTTCTGGGTTAGGAGGTTTGACTAATAAATTAACTCAGACCCAGATCTTTGACTACAGTGAGATACCAAACTTCCCCCAAAGTACAGTGCAAGGTCATGCTGGTCGACTGGTGTTTGGGTTCCTGAATGACAGAGCCTGTGTGATGATGCAGGGCAGGTTCCACCTGTATGAAGGCTACCCGCTCTGGAAGGTGACATTCCCAGTGAGGGTTTTCCAGCTTCTGGGTGTGCACACCCTCGTGGTCACCAATGCAGCTGGAGGGCTCAACCCCAAGTTTGAGGTTGGAGACATCATGCTAATCCGCGATCACATCAACCTACCTGGTATTTGCGGTGAGAACCCTCTCATAGGGCCCAATGATGAAAGGTATGGAGTTCGTTTTCCTGCCATGTCCGATGCCTATGACCGGGAGATGAGGCAGAAGGCTCATAGTACCTGGAAACAAATGGGAGAGCAGAGAGAGCTACAGGAAGGCACCTACGTTATGGTGACGGGCCCCAGCTATGAGACTGTGGCAGAGTCTCGTCTGCTGCAGCAACTGGGTGCAGATGCTGTTGGCATGAGCACAGTACCAGAAGTTATAGTTGCAAGGCACTGTGGACTTCGAGTCTTTGGCTTCTCCCTCATCACGAACAAGGTCATCATGGATTATGAAAGCCTTGAGAAAACAAACCATGAGGAAGTACTAAAGACCGGGAAACAAGCTGCGCAGAAATTGGAGCAGTTTGTCTCCATTCTTATGACTAGCATTCCACTGCCTGACCATGCTAGTTAACCAGCCCTGGGGTGGTCTGGCTTCTCCCTTATGGTTTCCAAGTAGTTGCTACCTACTTTGCTGGGGTCACATGCCTCTGTCCTTACGCAGTAGCAGAAAAGAGAGGAAGATTTTTATATTTCCCTTTCCCACTTCTCCCACCAGATTCTTCTGGTGCTGGGTCCTCTTTTGCTCAATTGTCTTCTCAAAACAGTGTCCACCTCTATTCTTTCACAAGAGCTGGAGCTCAAGCCAAGCCCTACTACACATCCATAGATATTTGATGTTGGCTGTTGAACTTGACACAGTAGAAGTCGATGCTAGCTTTTTGAGATGATGTTCTCACATTCCTGGGGACTCAGTTCTGCCTCCCCCAAAGTACTGGAAACCACACAAGGACCAGCCCAATACCTTTTATACTTTTAATGCTTTATATTTTGAAAATAAAGAGAAAGATGAAATAATTTCTTCATTTTTGTACAGTTGGGATTAGGCTGGGGCACAGTCCAAGATTGGCCTGAAAGGCTGTGAGACCACATGTGTTATTATGACTATTTGCTTTCTAGACAGGTAGCTAAGAACTGAGATGAGGCGCTATGTGAATGCAGGGAAGGATGAAGAAAAGGCAAGATGATGAAAGATAAAGATATTAGAAGATGATAAGGGAGAAAAGGCTAACTTCTGCGATATGATGGCCACTTCCCTAAGACCAGTCTTGCCTCTGTCCCTTGCCTTCTTTTTTCACCTCCTCTCTACTCTCATAAATATCTGAATTAGTTCACGATCTCCACTGTTCTTTCTCTTCCACTGTTGCCAGTTCCTTGTTAAGCCCTAATTATATTTCCTCCTTTTTT