Transcript asmbl_49773

Sequence
Transcript Sequence for observation asmbl_49773 of TGE0013196:
GCGGTCTCGGCCCGCGCGGTCCAGACGTACTTGGCTCGCCTGCGTGTGGCCGCGGTTGCGCGTCGACCATGGCGGTTACCGACGGATTGCTTCTCCACCTTTCCGAGCCCCCAGCCGCCGCCGCCGCCTTCAGGACGTTCTCCAGACCCCGCGTGGCCCAGGCGAGGCGGCAAGCACAGGCCACCAAAAGGAAGTACCAAGCATCCAGCGAGGTTCCCTCAGCGAAGCGGAGGAGCAGGGCATCCTCTCTGCCCGCTAAGAAAACCACCGCGGAAGGAGTGCAGAGGGCTCCCGAGGGGAGGGCGCAGACGGCGTCTTCCCCGCGGAGGTCTTCGGCCGGCGGCAGGGGTAGGAACCAAGAGCAGAAGCCATGCGTTAAGACCTCCTCGTTGTTTAAAAACAACCCCGAGATTCCAGAACTCCACAGACCCGTCGTACAGAAGGTGCAAGAAAAGGTGTTCTCTTCAGGTGCTTTTCATGACCTGGACCTCCACCCTCATTTGATTTCCACAATAAACACAGTCTTAAACATGTTCAACATGACCAGTGTTCAGATGCACAGCATTCCCGTGCTGCTGGAAGGCAGAGATGCCCTCGTGAGATCGCAGACCGGCTCAGGTAAAACTCTTGCCTATTGCATCCCTGTGGTCCAGTCCCTTCAAGCAATGAAAACGAAAATACAGCGCAGTGACGGCCCCTATGCTCTGGTGCTGGTGCCCACGAGAGAGCTGGCTCTACAAAGCTTTGACATCTTCCAGAAACTTCTCAAGCCGTTCACTTGGATTGTGCCCGGAGTGCTCATGGGAGGCGAGAAGAGAAAATCGGAAAAAGCCAGACTCCGCAAGGGAATAAATATCCTTATCTCAACTCCGGGGCGACTGGTGGATCACATCAAATCCACAAAGAACATTCATTTTAGCCGGGTACAGTGGCTGATTGTGGATGAAGCCGACAGAATCTTGGATTTGGGTTTTGAGAAGGATATCACAGTGATACTCAATGCAGTCAATGCCGAGTGTCAGAAGCGACAGAACGTCTTGCTGTCGGCGACACTCACGGAAGGGGTGGCCCAGCTCGCCGATATCAGTTTACTCAACCCAGTCAGTATTTCTGTCCTGGAAGAAGGCTACGGACAGGCTAACCCACAGGGCGGAGGAGCTCTTGAAGTCTCCGCTCCACAAACCAGCGACGAGTTGGACAGCTTCGCGATACCGGAGGGTCTCGATCAGCACGTGACCTTGGTTCCCAGCAAACTGAGGCTGGTCTCCCTGGCGGCCTTCATCCTGCAGAAGTGCGCGTTCGCAGCCGACCAGAAGATGATCGTCTTTTTCCCGAGCTGCGAGCTGGTGGAGTTCCACTACACGCTCTTCGTCCAGACCCTGCTGCCCCGCCCGGGAGCCCCGGCCGCGGCGCCCTTACCATCCGGCTCCACGCAGTTGAAGTTCCTGCGGCTGCACGGGGGTCTGGAGCAGGAGGACAGAATAGCCGTGTTTCAAGAATTCTCCCATTCCAGAACGGGCGTTCTCCTTTGCACGGACGTTGCGGCTCGGGGCTTAGATCTCCCTCAAGTCACGTGGATTGTTCAGTACAACGCTCCGTCTTCGCCGGCTGAGTACGTCCACCGGGTTGGGAGAACTGCCCGCATTGGCTGCCGGGGGAGCAGCCTGCTCATTTTGGCTCCTTCGGAGGCAGAATATGTCAACTCGTTGGCTTCTCACAAAATCAATGTTTCCGAGATTAAGATGGAAGATATTTTGTCTGTTCTGACAAGGGATGATTGTTTTCCGGGGAAGCAGTGGGGAAAGCAGAAACCCCGTGCCTTGAGCCCCCAGGGGATCCGAGAGCGAGCCACGGTCTTGCAGACGGTGTTTGAAGATTACGTGCACTCCAGTGAGCAGACGGTCTCCTGGGCAAAGAAAGCCCTGCAGTCCTTCATCCGTGCCTACACCACCTACCCCCGAGAGCTGAAGCACATCTTCCACGTTCGGTTGCTGCACCTTGGGCACGTGGCTAAGAGCTTCGGGCTAAGAGATGCGCCCCAGAATCTTAGCGTCTCGGCCGTAAAAAAGAAAAAAGCCGCCCCGAAAAGGCCTGACCTTCGGAAGAAGACCCAGAGTAAGCAGCGCCTTGCTGAAATCTTGCGTTCCGAATACGCAAGCGGGATGGAGGCTGGCATGGCCAAGGTCAGAAAGCAGAGCAAACAGGCCGACCAGGCAGCCGGCCGAGCGGCACGTCCGAGACCCGAGCCCGGCCTGGGCCGTGGGAAAAAGCAAAAGAAAAAACGCTCTCCGTGAAGGAGAGAAACCCAGAAAGGCTTACGAGGGACGAGACTCCCCAGAAAGTTGCTCTAAACTCTTCCTCCCCAGGACCGGGCCTGTGGCCCTGGTGGCACTGGATCGATGTCCCGCTCTCTTTTCAGAGGAGCCTTGGGACACGTACCAGTGCCACCTGTCCCTGATGACGGGCGTCCCTGCCACAGAGCGGCCACGGCCCCGTCTCCCACGGGGAGGGGTCAGCGGGGCAGGGAGTCAGTGGTTAGCCTGTGTCTTACAGCAGACACCTCACATCTTGTGTTCATTCTGTCAGCGCCCACACCTGCTTCACCCGTAGATCAGATGGTGCCCCCACGACTTAGTGCCTAAGCCTTGTCCTTACGTCAGCCAGGAGAGGCTGCGACCTGCCTGGTGACACGATCTGAAGAAATGTCTGTGTTCCTTTCTCCCGCCCCATCAGCGCCCATATGGGCGTGAATTTTGTAAAGTAAGATATCAAACTCCGGACTTCAATTTGTCAAAGAAGAAAATATTTATCAGATCACCTTCTCGATGTCTAAATGCTCGTGAGAGAGGATGGAAGGGGTTCGGGTGTGAGTCCCCGCGGTCAGCCCTCCTGGTTCCCGTCCGGGCTGCCCCCACCTCCAGACCACATGCGCAGGCATTGCTGGTGCCCCCCACATCCACGGAAAACTGATGCTCAGGACTAATTGACTTGCTGTCGCCGTTTTATCATTCGCCTTTGAAGTCAAAGGCTCCAGTGTCCTGAGCTTTTTCTCTCATGGAATCCGGTCCCCTCCAAGAAAGGCCTGAGGTCTTTGTACTGTGGCCCAGGCCACAGCTGCCCCGCCCCCATTGTGTTTCCTGGGAAGTTTGAAAGGGACCCCCAGGGCGTATTGATTTCCCAATAAATGTAAGATTTGGACACGGGTGACCGCAGAGGGTGCGGGGAGGTGGGGGGAGGGGGCGGGGAAAGCCACAGCACCTCTGTCCCGCTGCGGCCTGCCCTCTACTTGCCCCCTGCTCCCAGTGCCCCGTCTTCCTCCTCTGACCCCTGGGTGGGTGTGGAGGCCCCACTTCAGTAGGCTCTCCAGACCCACATGGGCTAAGTGACCGGGAAGGGATCCTGAGAGCTGCAAGGTGGGCCATTCCGTGGGGACCACGGAGGGGTCAGCATCCTCGCCGCTTTCTCTACCTGGCAAACGCATGTGGGACGCCCACACCAGGAAGGGCTCCTGGGTGAGGGCCAGCGTGAGCGTGCCAACACCTCGCCTCCCAGAGTCGGCTGTCACATGCGAACTACTAGCAATCGTTGGCGAAATTTGTAGTAATAATCATAATAAAACCTGCAGCACATGTCATGCTGATTTGGGGCAAATCTGCCACTTTTCTTTTATTTTGATGTACGGCG