Transcript asmbl_49691

Sequence
Transcript Sequence for observation asmbl_49691 of TGE0005878:
GGCACACACTGGCCCCGGTGCCCACCCGCACCCCACCCCCAGAGCGCTGACTCGGCTCCCCGGACCTCGGCAGGATGGAAGAGAAGCTGAAGAAAACCAAGATCATCTTTGTGGTGGGCGGGCCCGGCTCGGGGAAGGGCACCCAGTGTGAGAAGATTGTCCAGAAGTACGGCTATACTCACCTTTCCACCGGGGACCTCCTGCGGGCCGAGGTCAGCTCGGGCTCGGCCAGGGGCAAGATGCTGTCGGAAATCATGGAGAAGGGGCAGCTGGTGCCGCTGGAGACAGTGTTGGACATGCTCCGAGATGCCATGGTAGCCAAGGTAGACATTTCCAAAGGCTTCCTGATCGATGGCTACCCTCGGGAGGTGCAACAGGGGGAAGAGTTTGAGCAGAGGATCGGACAGCCCACGCTGCTGCTGTATGTGGACGCAGGCCCCGAGACCATGACCAAGCGGCTCCTGAAGCGGGGAGAGACCAGCGGGCGTGTGGACGACAACGAGGAGACCATCAAGAAGCGGCTGGACACCTACTACAAGGCCACAGAACCTGTCATTGCCTTCTATGAGAAACGTGGCATCGTGCGTAAGGTCAATGCCGAAGGCTCCGTGGACAGTGTCTTCTCCCAGGTCTGCACCCACCTAGACGCCCTCAAGTAGCAGCGCCGGAGCCCCTTCCCCAGCTCAGAGCCCCACCCCACCCCTGTCCTGACTCAAGAACCCTGGCCTGAGCTCAGCGCCTCCGCCCTGCCCGCTGGAGCACAGACAGAGGAAGCCACTTTATCCTGTTTTCATGGACAGCTGAGCACTAAAGGAATTTCCGAGGACATTCGGTTTTACTCCTTTTTCTTTGCTTCCATCGGGGTTGATTCATGTGGGGTGGCCGCCCTGGCCTCGAGCCCCTCACCCTCCCCATTCCTCCTCAGGTCCCTCAGCCCACCTTGGCCGGCCGCCCCTCCCCAGTAGAAGGTCCCCTTCCTCACACAGGGTGTGCCGAGCTCAGACTGGGCCAGGCCTGGGGAGCCAGGGTCCTTGCTTTCTGGGACTCGTGGTCAGACAGAGCTGGGCCCTGGCCTGGATTCCTCTGCATTCTTGCTGTGTGGACTTGGCCCTGACCCCTCCTGTCTCTGAGCCCGTTTTCTGTGCCTAACCTCCTCTGGGGACTGAGCCATAGCAGGCAACAAGGTCATGGGCAGCGTGGGGCTCCCTGGTGGTGGGGGCAGCACACGTCGGCAAGCCAGGTGGGCAGGAAATTGGCCACCTTGGTACAAGAAGCCCCGAGGGTCTGAAAAGGACATCAAGAGTGAATGGGGGGAAGGGGTCAAGGTCAGGAGAGCCTCCCCGAGGAGGTGAGACCTGAAAGTCTTCCCACCATGTGGCCCTGGACAAGTCACAACCTGTCTTTCCTAAGGCCATTTCAAAATTTAAATTAGGCTCAGTGCCCAGCCCCCCCAGGTCAGGAAGAGAACTCACTAAACAGAGTGCGTAGGCTGTCAGGTACCGAGGCCCGTGGGAGCCAGAGGCCAGAGCAGCCTTGGGGATGTGCCAGGCTGGGGTGCTCTGGGGAGGCCCCAGAATCCCCTGGGGAGAACCATCTCTTCTTTTCTGTTCTTTCACTCTTTGACCTTGTCACGGAGAAAGGCTCCGTTTGGTGCTCACGTGTCCTAAACACCCACCCCAGCCCCAGCTGGCTCTCTTTAAAGCCAAGACAGCCCTGAGCGGGCCACACCTGGCTGGAACGGAACCCCATGTGGGCTGATTGTGCCTGTCATGTGTCCC